bsss each may consist of several btss controlled by one base station controller bsc a bis is the interface between bsc and bts
Crossing the Wires: The Interface between Law and Accounting and the Discourse Theory Potential of Telecommunications Regulation
... Accounting is an Inappropriate Paradigm 115 I II A III Evaluating Positivism and the Interface of Law and Accounting 120 Why Interpretivism in law and Accounting is an inappropriate Paradigm 121 A ... Telecommunications The Interface between Law and Accounting Insights on the Interface between Law and Accounting 66 67 70 The Interface of Law and Accounting in the Telecommunications Act 2001 73 A Accounting ... relevance of discourse theory to the interface of law and accounting Consequently, the thesis investigates the formation and discursive enunciation of standpoints of political identities characterised...
- 368
- 624
- 0
Tài liệu Báo cáo khoa học: Mechanisms of obesity and related pathologies: Androgen deficiency and endothelial dysfunction may be the link between obesity and erectile dysfunction pptx
... state Central (abdominal) obesity, as assessed by several characteristics including BMI, WC and WHR, is considered as a hallmark of the MetS and is associated with reduced plasma androgen levels ... hypogondoropichypogonadism The increased aromatase activity of the visceral and peripheral fat further diminishes the levels of testosterone and increases the levels of estradiol (E2), which further contributes ... endothelial cell apoptosis and may reduce the risk for atherosclerosis by reducing vascular expression of adhesion molecules and foam cell formation and vascular smooth muscle cell proliferation...
- 13
- 662
- 0
Tài liệu Closing the gap between research and practice: Foundations for the acquisition of literacy pptx
... to a common approach to the teaching of literacy in classrooms across Australia The essential characteristic of a holistic approach to language learning, as identified by van Kraayenoord and Paris, ... developmental uses of literacy’ (van Kraayenoord and Paris, 1994, page 219) It is this belief that distinguishes holistic and whole language approaches to the teaching of reading from approaches based ... in Australia of the importance of phonemic awareness and the need for more balanced approaches to the teaching of reading, there is as yet little evidence of a major shift from the holistic and...
- 46
- 1,122
- 0
Tài liệu Báo cáo Y học: Role of electrostatics in the interaction between plastocyanin and photosystem I of the cyanobacterium Phormidium laminosum ppt
... charges of the protein at the active site are relevant, and these can be represented by a disc of fixed radius and uniform charge The same analysis has been used for the interaction between Cyt f and ... interaction of plastocyanin with photosystem I in Anabaena [15], and is highly conserved in cyanobacterial plastocyanins Mutagenesis, expression, purification and characterization of the plastocyanins ... of activation parameters This analysis was based on the transition state theory of Eyring [37] The interpretation of the activation parameters in Table depends on whether the reaction is diffusionlimited...
- 10
- 673
- 0
An Outline of the Relations between England and Scotland (500-1707) doc
... relating to the spoken language of Lowland Scotland and to its An Outline of the Relations between England and Scotland (500-1707) place-names The fact that the language of the Angles and Saxons ... alienated from the cause of Scotland were the Highlanders of Argyll and the Isles, some of the men of Badenach, and certain Galloway clans But that this opposition was personal, and not racial, ... crown by Alexander II, and who had been one of the claimants of 1290 His grandfather had done homage to Edward, and Bruce himself had been generally on the English side, and had fought against Wallace...
- 104
- 639
- 0
Báo cáo khoa học: In vitro analysis of the relationship between endonuclease and maturase activities in the bi-functional doc
... 5¢-AGCTTGTTACAG-AGAAACCTCCTCATG-3¢; AnI17R 5¢-AATTCACGAGGAGGTTTCTCTGTACTA-3¢; AnI17H 5¢-AGCTTAGTACAGAGAAACCTCCTCG TG-3¢; AnI15R 5¢-AATTCACAGGAGGTTTCTCT-GTC TA-3¢; AnI15H 5¢-AGCTTAGACAGAGAAACCTCC TGTG-3¢ Each annealed ... not displace or inhibit cleavage of the DNA if I-AniI has already reached the recognition site (Fig 5E) When a saturating amount of RNA substrate was bound before the DNA substrate, DNA cleavage ... dissociation of the proteinÆDNA complex Furthermore, the fact that the protein was saturated with the same amount of either substrate (Fig 4) argues against the trivial explanation that only a...
- 12
- 483
- 0
The interaction between climate and the processing of coated papers in printing and finishing pot
... that will always exist between the humidity of the air separating individual sheets of paper in a stack and the humidity of the paper itself Humidity balance, then, is the relation between the humidity ... aware of the issue, and take these dimension variations into account during pre-press and actual print run Apart from that, the problem of misregistering caused by absorption of moisture has ... The basic design is the same in all cases: a series of spray nozzles, operating on compressed air and spreading a thin mist of water The installation automatically maintains the required air humidity...
- 22
- 523
- 0
HEALTH BEHAVIOUR OF THE ELDERLY: BETWEEN NEEDS AND REALITY - A COMPARATIVE STUDY – doc
... within a broad multinational and multicultural context This qualitative and quantitative analysis serves as support for the elaboration of an intervention plan adapted to the needs of each specific ... project, the intervention and the project may be considered a success Health in Romania and Sweden In Romania, health care is generally poor by European standards, and access is limited in certain ... up these statements we can point to the high number of deaths caused by cardiovascular disease, aggravated by these unhealthy eating habits Taking into account the differences that exist between...
- 9
- 624
- 0
Báo cáo hóa học: " Research Article Analysis of the Tradeoff between Delay and Source Rate in Multiuser Wireless Systems" docx
... and the channel conditions (SNR, target BER) are captured in the mean and the variance mu and σu Thus, the evaluation of the user rates comes down to obtaining the mean and the variance of the ... by the MAC layer: a selected scheduling discipline and a QoS constraint given in terms of a delay constraint and a BER The delay constraint consists of a target delay Dt and the probability of ... Then, the the arrival process of each user generates source data at the (constant) rate Ru t ,ε D The simulation is run and the tail probability of exceeding the target delay is measured based...
- 13
- 530
- 0
Báo cáo hóa học: "Rapid detection of sacbrood virus (SBV) by one-step reverse transcription loop-mediated isothermal amplification assay" pptx
... -3′) AAGGAACTATAGTATGGCGAA CTGTTGCTGGTCTCTTGT TGGACCTACAAATTGCACCAATATAACCTCTTACAGTTGCAAAGTG AAGGACCCAGAGTGATGAGGTATGTATTTTCTTCCTTGGAACTT CTCTTAGCTGCTAGTTCTGAAGC CCCTCGAAAGAATCTATTCAGGG The RT-LAMP ... Science All samples were stored at −20°C before RNA extraction Total RNA was extracted from SBV isolates using an RNA extraction kit (TaKaRa Biotechnology, Dalian, China) according to the manufacturer’s ... reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay was developed for the rapid identification of SBV The data demonstrated that, in a simple water bath, SBV RNA could...
- 9
- 266
- 0
Báo cáo hóa học: " Research Article On the Connection between Kronecker and Hadamard Convolution Products of Matrices and Some Applications" pptx
... instead of Mm,n The notation AT t is the transpose of δ t In are the Dirac delta function and matrix function A t The notations δ t and Dn t Dirac identity matrix, respectively; here, the notation ... if A t , B t ∈ Mn , and Dn t Dirac identity then we have i A B t ii A ∗ B t if and only if A t and B t are both diagonal matrices; A B t •Dn t A Dn t ∗ B•Dn t Journal of Inequalities and Applications ... then we have α2 A1 t ∗ AT t • A2 t ∗ AT t α2 ≥ α1 α2 A1 t A t 2α1 α2 T ∗ A1 t A2 t A1 t ∗ AT t • A2 t ∗ AT t 3.12 By simplification we have A t ∗ AT t • A2 t ∗ AT t s A1 t ∗ AT t • A2 t ∗ AT...
- 10
- 325
- 0
Báo cáo y học: " Open Access The association between bullying and early stages of suicidal ideation in late adolescents in Greece" pdf
... of the Athens Greater Area (the district of Kallithea was selected), c) all senior high schools of one island in the Aegean Sea (the island of Paros was conveniently selected) All students in the ... pattern of associations with sociodemographic factors and psychiatric morbidity is the same between these groups and any observed differences are of a quantitative rather than a qualitative nature ... subjectively assess their family’s financial condition by asking them whether their family was having any financial difficulties (measured on a 4-point scale: no, few, some, a lot) Statistical Analysis All...
- 9
- 483
- 0
Báo cáo y học: "Where is the difference between the genomes of humans and annelids" pot
... Indeed, the human haploid genome contains more than billion nucleotides, or 3.5 picograms (pg) of DNA According to the Animal Genome Size Database [9] this is several times more than the haploid ... between an organism’s morphological and functional complexity and the absolute size of its genome Some invertebrates have a genome size comparable to that of humans [10,11] The well-known example of ... of the unicellular Amoeba dubia, with a genome 200 times larger than that of humans [9], demonstrates that mere DNA length does not determine an organism’s complexity The major fraction of an animal...
- 2
- 384
- 0
lei - determinants of cg and the link between cg and performance - evidence from the uk using a corporate governance scorecard
... 70.00 69.00 69.00 69.00 69.00 n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a 82.00 81.00 77.00 73.00 73.00 ... formats and many of the key variables needed in our study are not available in COMPUSTAT database For each of the remaining industrial and commercial firms, with at least three years of annual ... average years of directors stayed in board NOD: total number of directors RISK_D: a dummy variable equal to unity if RISK data are available, and zero otherwise RISK: the standard deviation of idiosyncratic...
- 100
- 321
- 0
The mechanism of action of sprouty2 characterization of the interaction between sprouty2 and PKCdelta
... depends on the balance between GEFs and GAPs There are three main isoforms of Ras, namely H-, K- and N-Ras They share approximately 90% similarity over most of their sequences, and are most divergent ... point of receptor-ligand binding, upstream of Ras, upstream of Raf, and at the level of or downstream of Raf (Guy et al., 2003; Kim and Bar-sagi, 2004) The study conducted by Casci and colleagues ... activation of Ras and downstream propagation of the signal The central role of the Ras-ERK pathway in development, together with the critical function of Grb2 within this pathway, implies that...
- 209
- 984
- 0
The intervention of plants in the conflicts between buildings and climate a case study in singapore
... to the frequent appearance of overcast days The flora of Singapore is well-known by tropical standards - the humid tropical types of plants The island has a variety of vegetation species ranged ... at a faster pace compared to that in rural areas The blocky and angular buildings are always replacing the soft shapes of trees, shrubs and grass with asphalt, brick, concrete and glass Basically, ... stones or rocks The roofs of the houses correspond to alpine meadows and pastures The façades of the houses are slopes, vineyards and terraces The windows have the appearance of caves and the...
- 336
- 414
- 0
In this paper, we investigate the relationship between migration and species distribution in multizone environment. We present a discrete model for migration of three competing species over three zones. We prove that the migration tactics of species leads
... dormant, ”hot” if the dormant has the same failure rate as an operating one, and it is called ”warm” otherwise • FDEP The FDEP gate has one main input connected to a component or another gate and ... if they are dormant but the failure rate of a dormant (λd ) is lower than the failure rate of the component in operation ( a ) A spare component may be ”cold” if its failure rate is while it is ... bound of the transition rate n out of any state: δ = i=1 (µi + λi ), where µi is the reparation rate of component i and λi is the maximum of the failure rates of component i Most of the component...
- 8
- 292
- 0
Sumary: The difference of the culture between Vietnam and US (lesson in the university)
... the altar And finally, after 100 days, the family celebrates, or the end of the tears After one year is the ceremony of the first anniversary of the relative's death and after two years is the ... in a restaurant or café Talking to your boss or teacher Talking to friends in a group Talking to a stranger One seat apart feet apart seat apart – feet apart – feet apart – feet apart Page Talking ... 27th - This is a day that everyone is the citizen of Vietnam has to remember the contribution of each veteran Christmas Day - Dec 25th - This is the Christian holiday celebrating the birth of Jesus...
- 11
- 396
- 4
The Relationship between Interdependence and the Outcome of Decision Making
... Incalcaterra, K A. , Joshi, A & Beaubien, J M (2002) A Meta-Analysis of Team-Efficacy, Potency, and Performance: Interdependence and Level of Analysis as Moderators of Observed Relationships Journal ... significant loadings on their associated factors The results of the three analyses conducted showed that the influence of common method variance is statistically not substantial, and that the answers ... regressed on each of the mediators (step of Baron and Kenny) The first column (M0) shows the null model, indicating that 24 percent of the total variance of the dependent variable is explained at the...
- 34
- 319
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008