breaking tolerance in a mouse model of multiple myeloma by chemoimmunotherapy

Báo cáo sinh học: "Combination immunotherapy and active-specific tumor cell vaccination augments anti-cancer immunity in a mouse model of gastric cancer" pdf

Báo cáo sinh học: "Combination immunotherapy and active-specific tumor cell vaccination augments anti-cancer immunity in a mouse model of gastric cancer" pdf

Ngày tải lên : 18/06/2014, 22:20
... Ishihara Y, Yamada A, Tanaka N, Itoh K, Harada M, Todo S: Immunological evaluation of personalized peptide vaccination in combination with a 5-fluorouracil derivative (TS-1) for advanced gastric ... fluorescein isothiocyanate (FITC)-conjugated anti -mouse Gr1 mAb (RB6-8C5; Ly-6G, Ly6C) Allophycocyanin (APC)-conjugated antimouse CD25 mAb was obtained from Invitrogen For staining of intracellular ... determined whether late appearance of Tregs actually has an impact on the therapeutic efficacy of the overall anti-tumor response A recent study reported that the use of multiple vaccinations had a...
  • 14
  • 454
  • 0
báo cáo hóa học: " Oral administration of the KATP channel opener diazoxide ameliorates disease progression in a murine model of multiple sclerosis" ppt

báo cáo hóa học: " Oral administration of the KATP channel opener diazoxide ameliorates disease progression in a murine model of multiple sclerosis" ppt

Ngày tải lên : 19/06/2014, 22:20
... oral administration of diazoxide constitutes an appropriate therapeutic approach for treating MS and other demyelinating diseases involving neuroinflammation and neurodegeneration Additional material ... demyelination, number of inflammatory/ infiltration lesions, reactive microglial-macrophage areas, astrocytic reactivity and number of infiltrating cells To assess axonal loss area and for neuronal ... and quantify areas of axonal loss in the spinal cord of diazoxide-treated and vehicle-treated EAE mice Diazoxide-administered EAE mice showed a significant decrease in the percentage of axonal...
  • 18
  • 422
  • 0
Multi-tissue gene-expression analysis in a mouse model of thyroid hormone resistance docx

Multi-tissue gene-expression analysis in a mouse model of thyroid hormone resistance docx

Ngày tải lên : 09/08/2014, 20:20
... that genes in category A may, in some instances, be modulated by TR-independent pathways: a notion supported by recent studies demonstrating that T3 can act in alternate pathways independent of ... the amplification of APC, carbonic anhydrase 4, lysyl oxidase and somatostatin cDNA A total of 32 cycles were used for the amplification of tenascin C, enolase 3β (muscle) and creatine kinase ... 5'-GAGTTAAGGAAGAGATATGGG-3'; tenascin C forward primer 5'-TTCGTGTGTTCGCCATCTTG3'; tenascin C reverse primer 5'-GTGTGAGGTCGATGGTGGT3'; carbonic anhydrase forward primer 5'-TCACTGCTAGGACAAAGGTG-3';...
  • 17
  • 459
  • 0
Báo cáo y học: " Modulation of lung inflammation by vessel dilator in a mouse model of allergic asthma" doc

Báo cáo y học: " Modulation of lung inflammation by vessel dilator in a mouse model of allergic asthma" doc

Ngày tải lên : 12/08/2014, 14:20
... of NPRA in mice resulted in less lung inflammation [11] Inhibition of NPRA by small inferfering RNA against NPRA attenuated lung inflammation in a mouse model of asthma [10] There is a feedback ... in modulating lung inflammation In this report we show that overexpression of VD attenuates airway inflammation in a mouse model of allergic asthma The effects of VD on airway inflammation may ... Natl Acad Sci USA 2005, 102(49):17723-17728 Thomas PG, Carter MR, Da'dara AA, DeSimone TM, Harn DA: A helminth glycan induces APC maturation via alternative NFkappa B activation independent of...
  • 8
  • 340
  • 0
Báo cáo y học: " GITR signaling potentiates airway hyperresponsiveness by enhancing Th2 cell activity in a mouse model of asthma" ppt

Báo cáo y học: " GITR signaling potentiates airway hyperresponsiveness by enhancing Th2 cell activity in a mouse model of asthma" ppt

Ngày tải lên : 12/08/2014, 14:20
... Statistical analysis All data are expressed as mean ± standard error of mean (s.e.m.) After log transformation, airway responsiveness to methacholine was statistically analyzed by a general linear ... Total Rat IgG DTA-1 Treatment Figure GITR stimulation aggravates AHR and serum IgE responses in a mouse model of asthma GITR stimulation aggravates AHR and serum IgE responses in a mouse model of ... characterized by AHR, induction of specific IgE and airway eosinophilia We show for the first time that AHR is dramatically increased by GITR triggering at the time of allergen challenge, resulting in a...
  • 8
  • 297
  • 0
Báo cáo y học: " Altered retinal microRNA expression profile in a mouse model of retinitis pigmentosa" docx

Báo cáo y học: " Altered retinal microRNA expression profile in a mouse model of retinitis pigmentosa" docx

Ngày tải lên : 14/08/2014, 08:20
... following additional data are available with the online version of this paper Additional data file is a table listing retinal miR expression data from Exiqon microarray analysis Additional data file ... out inalso provided age Global rankedprovided Retinalage a variance data out ranked and P347S retinasvalues Additionalforratios are ratios was carried retinaltriplicate.Student's Click herealso ... is a table listing retinal miR expression data from Ambion microarray analysis Additional data file is a table listing highly ranked retinal miR target genes predicted using miRanda The miRNA array...
  • 12
  • 336
  • 0
Báo cáo y học: "Modified cell cycle status in a mouse model of altered neuronal vulnerability (slow Wallerian degeneration; Wlds)" pot

Báo cáo y học: "Modified cell cycle status in a mouse model of altered neuronal vulnerability (slow Wallerian degeneration; Wlds)" pot

Ngày tải lên : 14/08/2014, 20:22
... 2008, Data analysis All non-SuperArray data were collected in Microsoft Excel and all statistical analyses and graphs were produced using GraphPad Prism Quantification of cytoplasmic and nuclear ... NM_009673 A0 1 -4.00 1.50 Apoptosis signaling Ataxia telangiectasia mutated homolog (human) Atm NM_007499 A0 2 -4.99 0.70 DNA damage and repair Caspase Casp1 NM_009807 A0 5 -6.81 7.58 Apoptosis signaling ... Checkpoint and arrest and regulation Anaphase promoting complex subunit ANAPC2 NM_013366 A0 2 3.76 0.63 G1 phase and G1/S transition and regulation Growth arrest and DNA-damageinducible, alpha GADD45A...
  • 21
  • 287
  • 0
Báo cáo y học: "Diarrhea as a cause of mortality in a mouse model of infectious colitis" ppt

Báo cáo y học: "Diarrhea as a cause of mortality in a mouse model of infectious colitis" ppt

Ngày tải lên : 14/08/2014, 20:22
... performed on transformed data A p-value < 0.05 was regarded as statistically significant Abbreviations A/ E, attaching and effacing; AP, activator protein; AQP, aquaporin; CA, carbonic anhydrase; CFTR, ... anhydrases CA I and CA IV and aquaporins Aqp4 and Aqp8 [78-80] These results indicate that infectious diarrhea and noninfectious inflammationassociated diarrhea may have common mechanisms of pathogenesis ... for Assessment and Accreditation of Laboratory Animal Care and maintained on pelleted rodent chow (LabDiet, Purina Mills, Inc., Richmond, IN, USA) and water ad libitum At 12 weeks of age, infectious...
  • 19
  • 300
  • 0
Regulation of substance p and neurokinin 1 receptor expression in a mouse model of acute pancreatitis

Regulation of substance p and neurokinin 1 receptor expression in a mouse model of acute pancreatitis

Ngày tải lên : 09/09/2015, 17:54
... is an immunological response characterized by redness, swelling, heat, and pain localized to a tissue A rapid and prominent increase in pancreatic inflammation is a hall-mark of acute pancreatitis ... animal models of AP (Thrower et al., 2008) For example, a supramaximal concentration of caerulein (107 M) causes intra-acinar cell activation of trypsinogen and increased trypsin activity (Hofbauer ... are critical pro-inflammatory mediators in AP and the associated lung injury SP-NK1R interaction is also a determinant of inflammatory edema in acute interstitial pancreatitis (Maa et al., 2000b)...
  • 190
  • 432
  • 0
Gene expression changes in the brainstem and prefrontal cortex in a mouse model of orofacial pain

Gene expression changes in the brainstem and prefrontal cortex in a mouse model of orofacial pain

Ngày tải lên : 10/09/2015, 08:34
... an inflammatory response that induces pain This type of pain is known as inflammatory pain Inflammatory pain is due mainly to the action of prostaglandins and bradykinin, and substances released ... microarray-based approaches to examine gene expression and miRNA changes in the brainstem and prefrontal cortex in a mouse facial carrageenan injection model of orofacial pain At the brainstem level, increased ... 1.2 Major pathways for pain sensation from the body Adapted from Purves and Williams, 2001 13 Chapter I Introduction Orofacial pain Orofacial pain is defined by the American Academy of Orofacial...
  • 179
  • 428
  • 0
The role of interferon gamma in regulating antigen specific CD8 t cell responses in a mouse model of influenza

The role of interferon gamma in regulating antigen specific CD8 t cell responses in a mouse model of influenza

Ngày tải lên : 10/09/2015, 09:25
... 7-amino-actinomycin D   AF488 Alexa Fluor 488   AF549 Alexa Fluor 549   AF647 Alexa Fluor 647 APC Antigen presenting cell   APC Allophycocyanin   BAL Bronchoalveolar Lavage Fluid   BSA Bovine serum albumin ... Pathogenic Avian Influenza   IL Interleukin   iNOS inducible Nitric Oxide Synthase   IRF Interferon Regulatory Factor     JAK Janus Kinase   mAb Monoclonal antibody   MDCK Madine Darby Canine ... al 1999) Furthermore, the surface HA and NA proteins form antigens against which antibodies can be raised Neutralizing antibodies against HA and NA also help to prevent virus from spreading Another...
  • 263
  • 427
  • 0
Characterisation of lung dendritic cell function in a mouse model of influenza

Characterisation of lung dendritic cell function in a mouse model of influenza

Ngày tải lên : 10/09/2015, 15:53
... resulting in intracellular ionic imbalance and activation of the inflammasome (Ichinohe et al 2010) Although influenza infection results in activation of the inflammasome in both lung stromal and ... distinct signalling cascades and immune responses (Pang and Iwasaki 2011) This initiation of multiple signalling pathways ultimately culminates in the release of proinflammatory cytokines as well ... discrimination mechanism is particularly important given that host RNA are abundant within the cytosol Upon RIG-I binding to influenza vRNA, the CARD domains initiate a signalling cascade by associating with...
  • 222
  • 160
  • 0
Role of central nervous system ceramides and free radicals in a mouse model of orofacial pain

Role of central nervous system ceramides and free radicals in a mouse model of orofacial pain

Ngày tải lên : 14/09/2015, 08:42
... complicated because of the region’s density of anatomical structures, rich innervations and high vascularity Orofacial pain is defined by the American Academy of Orofacial Pain (AAOP) as “pain conditions ... ceramide in orofacial pain induced by facial carrageenan injection ICV injection of inhibitors to acid sphingomyelinase (ASMase), neutral sphingomyelinase (NSMase), or serine palmitoyltransferase ... surrounding structures Pain from these areas can be caused by local injury resulting from trauma, infection or neoplasms The ill-defined category of atypical oral and facial pain includes a variety of...
  • 178
  • 352
  • 0
Muscarinic mechanisms in a mouse model of myopia 1

Muscarinic mechanisms in a mouse model of myopia 1

Ngày tải lên : 16/09/2015, 08:31
... gallamine or alcuronium) Since then an increasing number of allosteric ligands that can decrease or increase in a subtype-specific manner classical muscarinic agonist and antagonist binding affinity ... renewed interest in the application of muscarinic-based therapies in the treatment of glaucoma since it now appears that acetylcholine influences both the production and drainage of aqueous humor and ... described an axial myopia in one eye, which had a posterior sub-capsular cataract in one sibling of a pair of identical twins Von Noorden and Lewis (1987) examined 10 young patients who had unilateral...
  • 121
  • 341
  • 0
Muscarinic mechanisms in a mouse model of myopia 2

Muscarinic mechanisms in a mouse model of myopia 2

Ngày tải lên : 16/09/2015, 08:31
... levels increased (up regulated) after induction of myopia and decreased (down regulated) in the atropine treated myopic and contra-lateral control In this set of data collated, atropine had an effect ... (up-regulated) after receiving atropine and also in contralateral control eye M2 (Figure 58) mRNA levels increased (up-regulated) after induction of myopia and after receiving normal saline In contrast, ... on atropine treated and saline treated sclera Lane 1: atropine treated myopic sclera, lane 2: atropine treated control sclera, lane 3: saline treated myopic sclera, lane 4: saline treated control...
  • 131
  • 334
  • 0
Effects of central nervous system free fatty acids, prostaglandins and lysophospholipids on allodynia in a mouse model of orofacial pain

Effects of central nervous system free fatty acids, prostaglandins and lysophospholipids on allodynia in a mouse model of orofacial pain

Ngày tải lên : 05/10/2015, 13:53
... data Ratio scale data is a type of cardinal data Cardinal data are on a scale where it is meaningful to measure the distance between possible data values There are two types of cardinal data: ... infection and neoplasms Neuralgic pain is generally expressed in the facial area as idiopathic trigeminal neuralgia The ill-defined category of atypical oral and facial pain includes a variety of pain ... data: interval scale data and ratio scale data For cardinal data, if the zero point is arbitrary, then the data are on interval scale For cardinal data, if the zero point is fixed, then the data are...
  • 91
  • 468
  • 0
Gene expression changes in the brainstem in a mouse model of orofacial pain

Gene expression changes in the brainstem in a mouse model of orofacial pain

Ngày tải lên : 07/10/2015, 09:55
... CHANGES IN THE BRAINSTEM IN A MOUSE MODEL OF OROFACIAL PAIN DR LUTFUN NAHAR NATIONAL UNIVERSITY OF SINGAPORE 2009 II GENE EXPRESSION CHANGES IN THE BRAINSTEM IN A MOUSE MODEL OF OROFACIAL PAIN ... trigeminal neuralgia, atypical facial pain, and temporomandibular joint pain (Claeys et al., 1992) Facial pain has many causes, including idiopathic factors, trigeminal neuralgia, dental problems, ... neuron in the sensory ganglion of cranial nerves VII, IX and X OROFACIAL PAIN The diagnosis and treatment of facial pain remains a great challenge for oral and maxillofacial surgeons The pain syndromes...
  • 104
  • 289
  • 0
Báo cáo khoa học: Differential expression of liver and kidney proteins in a mouse model for primary hyperoxaluria type I pdf

Báo cáo khoa học: Differential expression of liver and kidney proteins in a mouse model for primary hyperoxaluria type I pdf

Ngày tải lên : 23/03/2014, 03:20
... [8] indicate that its alanineglyoxylate aminotransferase activity is not favored over aminobutyrate-pyruvate, b-alanine-pyruvate and dimethylarginine-pyruvate aminotransferase activities In the ... Apolipoprotein A- IV Actin, b, cytoplasmic NSFL1 (p97) cofactor (p47) Aminoacylase Phosphoglycerate mutase Indolethylamine N-methyltransferase Peroxiredoxin Apolipoprotein A- I Abhydrolase domain containing ... Agt), alanine-glyoxylate aminotransferase knockout; Aldh2, aldehyde dehydrogenase 2; Car3, carbonic anhydrase 3; Cat, catalase; Dao1, D-amino acid oxidase 1; Eno1, enolase 1, a non-neuron; Fah,...
  • 9
  • 481
  • 0
Báo cáo y học: "Use of a highly sensitive strand-specific quantitative PCR to identify abortive replication in the mouse model of respiratory syncytial virus disease" pptx

Báo cáo y học: "Use of a highly sensitive strand-specific quantitative PCR to identify abortive replication in the mouse model of respiratory syncytial virus disease" pptx

Ngày tải lên : 12/08/2014, 01:22
... sense ATAGAATTCGGTATGTTATATGCGATGTCTAGGT1 In vitro standard nested positive sense ATAGGATCCTGCTAAGACTCCCCACCGTAA2 Positive sense RNA-specific cDNA synthesis CGGTCATGGTGGCGAATAATCCTGCAAAAATCCCTTCAACT3 ... Negative sense RNA-specific cDNA synthesis CGGTCATGGTGGCGAATAAACTTTATAGATGTTTTTGTTCA3 Positive sense-specific QPCR primer CGGTCATGGTGGCGAATAA Probe TCCTGCAAAAATCCCTTCAACT QPCR tag primer CCCCACTTTATAGATGTTTTTGTTCA ... domain was isolated using a nested primer approach RSV A2 viral RNA was prepared from crude preparation using the QIAamp viral RNA minikit (Qiagen) RNA was reverse transcribed using the High Capacity...
  • 11
  • 348
  • 0