boukhnifer c larouci and a chaibet
Tài liệu Debugging C and C++ code in a Unix environment ppt
... static analysis early; see the section called Using the compiler’s features Explicit storage allocation and deallocation In C and C+ +, you have to explicitly allocate and deallocate dynamic storage ... the causes of problems with C and C+ + code, is the policy of requiring explicit allocation and deallocation of dynamic storage (malloc(2) and free(2) (C) or new and delete (C+ +)) As C and C+ + ... 21 Chapter Aspects of debugging C and C+ + code System call tracers A system call tracer is a program that allows you to see what system calls (including parameters and return values) a process...
- 29
- 466
- 1
Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc
... 4118 Arp2 ⁄ complex De novo actin filament assembly is critical for actin-patch formation at polarized cortical sites [29] Because cortical actin patches are short-lived structures, continual actin-patch ... polyclonal GFP-speci c antiserum was a gift from J Kahana and P Silver (Dana Farber Cancer Center, Boston, MA) The anti-actin mAb was MAB1501 from Chemicon International (Temecula, CA) The anti-hexokinase ... C- Vrp1p364)817 charged-cluster residues K485R486 are essential for cortical actin-patch polarization Cortical actin-patch polarization in vrp1D (AMY88) cells carrying YCplac111 vector (vect), pAM236 expressing...
- 23
- 679
- 0
Tài liệu Báo cáo Y học: Use of site-specific recombination as a probe of nucleoprotein complex formation in chromatin Micha Schwikardi and Peter Droge ¨ potx
... interaction between dimers bound at accessory sites II and III, and the catalytically active ones at paired sites I that is required to trigger strand exchange is indicated by arrows Recombination ... Micrococcal nuclease digestion of nuclei reveals extended nucleosome ladders having anomalous DNA lengths for chromatin assembled on non-replicating plasmids in transfected cells Nucleic Acids ... blot analysis, PCR, and DNA sequencing revealed that they contain between one and about 20 copies of the substrate vector at different genomic locations Hence, the vector integrated probably randomly...
- 7
- 472
- 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx
... ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG ... CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R OMCB-PBAD-F OMCB-PBAD-R 3736 controlled by an arabinose promoter [26], was achieved as visualized by heme staining of SDS ⁄ PAGE gels ... Synthetic oligonucleotides used in this study Oligonucleotide name Sequence (5¢- to 3¢) OMCA-KO-F OMCA-KO-R OMCB-KO-F OMCB-KO-R OMCA-F OMCA-R OMCB-F OMCB-R OMCA-PBAD-F CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT...
- 11
- 731
- 0
The Project Gutenberg EBook of The Car of Destiny by C. N. Williamson and A. M. Williamson pot
... without making myself ridiculous by a foreign accent As for my brown face and black eyes, many a Cornishman has a face as brown and eyes as black; therefore, I edited the name of Triana into Cornish ... sits always in the tonneau, had already heard all about the King's automobile, and was primed with particulars He leaned across to describe its appearance, as well as mention the make; and when ... and went alone, rather than drag Dick into an affair which might end disagreeably I did not put myself forward, but stood for a while and watched the dancers, waiting for my chance Carmona had...
- 424
- 1,310
- 0
Báo cáo khoa học: Biochemical properties of the human guanylate binding protein 5 and a tumor-specific truncated splice variant Mark Wehner and Christian Herrmann doc
... hGBP1 and other large GTPases, we analysed the enzymatic activity of hGBP 5a ⁄ b and hGBP5ta in a concentration-dependent manner Various concentrations of purified hGBP 5a ⁄ b and hGBP5ta were incubated ... reflecting larger structural changes accompanying nucleotide binding The rate constants for nucleotide association and dissociation are both much smaller for hGBP5 compared to hGBP1, reflecting a ... showed an antiviral effect against speci c viruses [10,11], and an anti-Chlamydia effect [12], inhibition of endothelial cell proliferation [13] and their subcellular localization [14] have also...
- 9
- 462
- 0
Báo cáo khoa học: The proximity between C-termini of dimeric vacuolar H+-pyrophosphatase determined using atomic force microscopy and a gold nanoparticle technique ppt
... was cloned into the yeast expression vector pYES2 (Invitrogen, Carlsbad, CA, USA), 4390 and the two synthesized oligonucleotides Phis (5Â-CCTCG AGCCATCATCATCATCATCATTAGGGCCGCATCAT GTAATTAGTTATGT-3Â) ... (Digital Instruments, Santa Barbara, CA, USA) and a Picoplus instrument (Molecular Imaging, MI, USA) Muscovite mica (Electron Microscopy Sciences, Hateld, PA, USA) was freshly cleaved and immediately ... electrotransblotting apparatus (Nova Blot, Amersham Pharmacia Biotech, Piscataway, NJ, USA) The blots were incubated with the rabbit polyclonal antibody raised against the MAP (Mitogen-activated...
- 14
- 332
- 0
Báo cáo khoa học: Nucleosome positioning in relation to nucleosome spacing and DNA sequence-specific binding of a protein doc
... proteins at singular sites in an array of densely packed and equally spaced nucleosomes can cause substantial decondensation and rearrangements in condensed chromatin regions, working as trigger ... concentrations Naked DNA (lanes and 5) and chromatin assembled in the absence or presence of R3 protein are shown R3 was added to lanes 2, 3, and (C) IEL analysis for the chromatin assembled at 130 and 150 ... in lanes 1, 3, and 6, whereas chromatin was assembled at 50 mM salt for lanes 1–4, and at 70 mM salt for lanes 5–8 (B) IEL analysis for the chromatin assembled at 90 and 110 mM salt concentrations...
- 15
- 299
- 0
Báo cáo Y học: Incorporation of 3-nitrotyrosine into the C-terminus of a-tubulin is reversible and not detrimental to dividing cells potx
... Investigaciones Cientı´ ficas y ´ ´ Tecnicas (CONICET), Secretarı´ a de Ciencia y Tecnica de la Univer´ ´ sidad Nacional de Cordoba y Agencia Cordoba Ciencia del Gobierno ´ de la Provincia de Cordoba, ... y Tecnologica de la Secretarı´ a de Ciencia y Tecnologı´ a del Ministerio de Cultura y ´ ´ ´ Educacion en el marco del Programa de Modernizacion Tecnologica (BID 802/OC-AR), Consejo Nacional de ... were inactivated by addition of mL 5% trichloroacetic acid and heated at 90 C for 15 Radioactivity bound to protein was measured in hot-trichloroacetic acid-insoluble material as described previously...
- 9
- 518
- 0
Nicolai josutis the c++ standard library a tutorial and reference
... Standard Library 3.4 Allocators The C+ + standard library uses in several places special objects to handle the allocation and deallocation of memory Such objects are called allocators An allocator represents ... polymorphic value For example: class Car; virtual function) // abstract base class (has at least one class Cabriolet : public Car { }; class Limousine : public Car { }; void f(Car* cp) { Cabriolet* ... Cataloging-in-Publication Data Josuttis, Nicolai M The C+ + standard library: a tutorial and reference / Nicolai M Josuttis p cm Includes bibliographical references and index C+ + (Computer program language)...
- 642
- 408
- 1
Báo cáo khoa học: Platination of telomeric sequences and nuclease hypersensitive elements of human c-myc and PDGF-A promoters and their ability to form G-quadruplexes Viktor Viglasky potx
... approximately 263 nm and a negative band at approximately 240 nm, whereas antiparallel G4 structures, such as basket and chair forms, show two positive bands at approximately 295 and 240 nm and ... of action Proc Natl Acad Sci USA 104, 17347–17352 15 DeCian A & Mergny JL (2007) Quadruplex ligands may act as molecular chaperones for tetramolecular quadruplex formation Nucleic Acids Res 35, ... with cisdiammine-diaquaplatinum at comparable rates J Inorg Biochem 101, 514–524 23 Chang CC, Chien CW, Lin YH, Kang CC & Chang TC (2007) Investigation of spectral conversion of d(TTAGGG)4 and...
- 9
- 324
- 0
Báo cáo khoa học: The ‘pair of sugar tongs’ site on the non-catalytic domain C of barley a-amylase participates in substrate binding and activity potx
... Y38 0A, 5Â-GATCGGGTCCAGGGCCGACGTC -GG-3Â; Y380M, 5Â-GATCGGGTCCAGGATGGACGT CGG-3Â; Y380F, 5Â-GATCGGGTCCAGGTTCGAC GTCGG-3Â (underlined mutant codon) coding for the sense strand, and 5Â-TTTGGTACCTCAGTTCTTCTCCCAGA ... 5Â-TTTGGTACCTCAGTTCTTCTCCCAGA CGGCGTA-3Â as antisense primer Mutant cDNA was amplied using 5Â-TTTGAATTCCATGGGGAAGAACG GCAGC-3Â as sense orientation primer and a puried megaprimer Pfu DNA polymerase (Stratagene, ... Experimental procedures Strains, plasmids and AMY2 Escherichia coli DH 5a and P pastoris GS115, transformed with pPICZA (Invitrogen, Carlsbad, CA), were used for standard cloning and expression pPICZA-amy1D9...
- 13
- 385
- 0
Báo cáo Y học: The porcine trophoblastic interferon-c, secreted by a polarized epithelium, has specific structural and biochemical properties potx
... that the structural and chemical characteristics of TrIFN -c affects its bioavailability and biological effect(s) on the maternal uterus In particular, this shortened version of IFN -c, lacking a ... Sigma-Aldrich, USA) As a standard, porcine rIFN -c (CIBA-Geigy) was used at a concentration of 10 lgÆmL)1 Antiviral activity Antiviral activity was assayed by inhibition of the vesicular stomatitis virus ... native TrIFN -c was measured by gel-filtration, in comparison with those of crude LeIFN -c and unglycosylated rIFN -c Each column fraction was tested by antiviral assay and by IFN -c speci c ELISA...
- 10
- 380
- 0
Báo cáo khoa học: MicroRNA-23b mediates urokinase and c-met downmodulation and a decreased migration of human hepatocellular carcinoma cells doc
... cell extracts from control cells (lanes 1, 2, 4, and 5) and transfected cells (lanes and 6) at 48 and 72 h after transfection results showed a greater decrease in luciferase activity as compared ... hours and 72 h after transfection, total RNA isolations from control cells (lanes 1, 2, 4, and 5) and transfected cells (lanes and 6) were examined by RT-PCR to detect uPA mRNA (A) and c- met mRNA ... using RNU66 as an internal control RT-PCR analysis (Agilent) and real-time PCR Total RNA of transfected and nontransfected cells was extracted with Trizol reagent according to the manufacturer’s...
- 17
- 287
- 0
Báo cáo khoa học: Analysis of the CK2-dependent phosphorylation of serine 13 in Cdc37 using a phospho-specific antibody and phospho-affinity gel electrophoresis doc
... were analyzed after dephosphorylation for (lanes and 7), (lanes and 8), 10 (lanes and 9), and 20 (lanes and 10) antibody against Cdc37 and the only band that became radioactive after incubation ... k-phosphatase from Upstate Biotechnologies (Lake Placid, NY, USA) Horseradish peroxidase (HRP)-conjugated anti-Cdc37 (E-4) was purchased from Santa Cruz (Santa Cruz, CA, USA), anti-FLAG (M2) and anti-FLAG ... binding an activating regulatory coprotein to an inactive catalytic subunit can activate a kinase In many signal-transducing protein kinases, site-speci c phosphorylation by an upstream protein kinase...
- 14
- 342
- 0
Báo cáo khoa học: Disorder–order transition of k CII promoted by low concentrations of guanidine hydrochloride suggests a stable core and a flexible C-terminus doc
... http://www.nov agen.com/SharedImages/TechnicalLiterature/7_tb055.pdf Datta, A. B., Chakrabarti, P., Subramanya, H.S & Parrack, P (2001) Purification and crystallization of CII: an unstable transcription activator ... that is characteristic of aromatic residues Therefore it is apparent that below M, GdnHCl caused a conformational change in the CII protein with little change in tertiary interactions of the aromatic ... (1998) The Escherichia coli RNA polymerase alpha subunit and transcriptional activation by bacteriophage lambda CII protein Acta Biochim Pol 45, 271–280 Kobiler, O., Koby, S., Teff, D., Court, D &...
- 8
- 422
- 0
brodkey, r. s. and hershey, h. c. - transport phenomena - a unified approach
... Dimensions, Capacities, and Weights Condenser and Heat-Exchanger Tube Data Physical Constants, Units, and Conversion Tables Table C. l Physical Constants Table C. 2 SI Base and Supplementary Quantities and ... ftm3); C, and Ca are concentrations of species A and B; CT is total concentration Heat capacity at constant pressure (kJ kg-‘K-l, Btu Ib;‘T-‘); c, , is heat capacity at constant volume Diffusion coefficient ... Diffusivity Table C. 7 Force Table C. 8 Gravitational Conversion Constant Table C. 9 Heat Capacity Table C. 10 Heat Transfer Coefficient Table C. ll Length Table C. 12 Mass Table C 13 Mass Transfer Coefficient...
- 865
- 2,299
- 0
Báo cáo hóa học: " Research Article AWPP: A New Scheme for Wireless Access Control Proportional to Traffic Priority and Rate" pdf
... the Access Point (AP) The HCCA resource reservation mechanism defines that every Tra c Stream (TS) communicates its Tra c Specifications (TSPECs) to the AP The TSPECs include the MAC Service Data ... tra c packets based on their priorities This way, tra c can be differentiated and QoS can be supported Additionally, EDCA implements a collision avoidance technique using a two-way handshake, called ... in AWPP of tra c throughput to tra c load and the average delay in AWPP are depicted in Figures and 6, respectively As it can be seen, the analytical and the simulation results coincide to a great...
- 11
- 516
- 0
Báo cáo hóa học: " Nanoscratch Characterization of GaN Epilayers on c- and a-Axis Sapphire Substrates" doc
... original author(s) and source are credited Table Critical lateral forces and values of l determined from nanoscratch trace depths within GaN films on c- and a- axis sapphire substrates Sample Normal ... tribological and chemical effects, rather than physical deformation and fracture, are believed to become dominant In this scenario, the average measured residual stress in the cracking zone is much ... the dislocation recovery from elastic and/ or plastic deformation appear to be associated with the activation of dislocation sources brought about by the nanoscratching of the Nanoscale Res Lett...
- 5
- 276
- 0
SOLVABILITY CONDITIONS FOR SOME DIFFERENCE OPERATORS N. C. APREUTESEI AND V. A. VOLPERT Received 24 docx
... Bagisbaev and A B Bazarbekov, Solvability of a class of infinite algebraic systems, Izv Akad Nauk Kazakh SSR Ser Fiz.-Mat 153 (1990), no 2, 79–81 (Russian) P W Bates, K Lu, and B Wang, Attractors ... N C Apreutesei: Department of Mathematics, “Gh Asachi” Technical University of Iasi, 700506 Iasi, Romania E-mail address: napreut@math.tuiasi.ro V A Volpert: Laboratoire de Math´ matiques Appliqu´ ... finite-dimensional kernels Since at +∞ and −∞ the operators L+ and L− coincide, we finally reduce L to an operator with constant coefficients According to Theorem 2.4, it is invertible Therefore, L is a Fredholm...
- 13
- 187
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25