boldfacing the first word of a cell
Báo cáo khoa học: "PEAS, the first instantiation of a comparative framework for evaluating parsers of French" potx
Ngày tải lên :
17/03/2014, 22:20
... each relation the address of its parameters Of course, all of them are not to be filled in All the information thus annotated is then translated into an XML format Annotation of the example of ... number of parsers will allow the production of a good quality validated linguistic resource Indeed, we will produce the automatic fusion of all annotated data of the parsers, and then manually ... question answering application, where a parser is often needed to parse both the questions and the huge set of candidate answers, the use of XML makes easier the selection of the paser for the task at...
- 4
- 323
- 0
Báo cáo hóa học: " Research Article Optimum Detection of Ultrasonic Echoes Applied to the Analysis of the First Layer of a Restored Dome" pot
Ngày tải lên :
22/06/2014, 19:20
... areas where modifications had been made to the surface (a special type of paper was attached to the wall after preparation of the paintings) This a ected the transducer-wall coupling in such a ... give an adequate balance between resolution and the capacity to penetrate into the mortar It should be noted that mortar is a material composed of sand and cement paste Two essential parts of its ... be a correct estimate also for mortar (see the first part of the received signal in Figure 2) In any case, this is not a critical parameter and a raw estimate of the pulse duration suffices A different...
- 10
- 386
- 0
Báo cáo khoa học: The hyperfluidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx
Ngày tải lên :
07/03/2014, 12:20
... present case The heat-induced activation of kinases such as Akt has been shown to increase HSF1 activity Enhanced Ras maturation by heat stress was associated with a heightened activation of extracellular ... activation of HSP expression, awaits further studies We propose that, rather than the overall changes in the physical state of membranes, the appearance of specific microdomains [34] with an abnormal ... intermediates and their compartmentalization during activation of the stress response by heat or membrane perturbants await further studies As an indication of their delicate and hitherto unexplored...
- 10
- 452
- 0
Báo cáo khoa học: Unravelling the functional interaction structure of a cellular network from temporal slope information of experimental data docx
Ngày tải lên :
07/03/2014, 21:20
... kinases, a MAP kinase (MAPK), a MAPK kinase (MAPKK) and a MAPKK kinase (MAPKKK), are common signalling modules in eukaryotic cells [20,21] The budding yeast (S cerevisiae) has several MAPK cascades ... pathway for hyperosmolarity adaptation in budding yeast (Saccharomyces cerevisiae) and based on the related mRNA expression time-series data from Stanford Microarray Databases Results Inferring the ... intervention of other nodes or parameters Sontag et al [15] have proposed another complementary method based on time-series measurements, which can be useful when stationary data are not available and the...
- 10
- 375
- 0
Báo cáo khoa học: Purification, characterization, cDNA cloning and nucleotide sequencing of a cellulase from the yellow-spotted longicorn beetle, Psacothea hilaris ppt
Ngày tải lên :
17/03/2014, 10:20
... degradation activity of P hilaris cellulase against crystalline cellulose, Avicel (Merck) was used under the same conditions as the CMCase assay Optimal pH for P hilaris cellulase activity against ... N-Terminal amino-acid sequencing analysis indicated that the mature protein of P hilaris cellulase was a truncated form, which lacked a signal peptide composed of the first 21 amino acids Therefore, the ... 246–254 Da Lage, J.L., Maczkowiak, F & Cariou, M.L (2000) Molecular characterization and evolution of the amylase multigene family of Drosophila ananassae J Mol Evol 51, 391–403 Lo, N., Watanabe,...
- 6
- 361
- 0
Báo cáo Y học: Incorporation of 3-nitrotyrosine into the C-terminus of a-tubulin is reversible and not detrimental to dividing cells potx
Ngày tải lên :
17/03/2014, 10:20
... dividing the optical density of each band stained with antibodies to Glu- and nitrotyrosinated tubulin by that of an identical sample stained with DM 1A antibody Capabilities of nitrotyrosinated and ... 15 ACKNOWLEDGEMENTS 16 We thank Drs Carlos E Argarana and Mario Guido for critical ˜ reading of the manuscript, Mrs S N Deza and Mrs M G Schachner for technical assistance and Dr Stephen Anderson ... during the first two days and then remained constant or increased slightly (Fig 3B) At any given time, the majority of the cells (> 90%) were viable These two parameters (viability and proliferation)...
- 9
- 518
- 0
The first three minutes a modern view of the origin of the universe s weinberg
Ngày tải lên :
17/03/2014, 13:35
... of the Heavens suggested that the nebulae 'or rather a species of them' are really circular discs about the same size and shape as our own galaxy They appear elliptical because most of them are ... this apparent paradox, including perhaps the steady-state theory It may be that the removal of the age paradox by the tenfold expansion of the extragalactic distance scale in the 1950S was the ... points A and B are the same, draw a circle through A around galaxy 1, and another circle through B around galaxy Isotropy around galaxy requires that conditions are the same at A and at the point...
- 168
- 414
- 0
THE FIRST BANK OF THE UNITED STATES - A CHAPTER IN THE HISTORY OF CENTRAL BANKING pdf
Ngày tải lên :
22/03/2014, 21:20
... Historical and Architectural Data,” Philadelphia: Independence National Historical Park, April 1981 The First Bank of the United States 11 rates and thus bank profits Without the restraining hand of ... PHILADELPHIA In 1789, he became assistant secretary of the Treasury THE LIBRARY COMPANY OF PHILADELPHIA 1800, Adams left Philadelphia for the new capital city, the College of New Jersey (later Albert ... with the bank to accept the post of president of the first Bank of the United States Smith first pursued an academic career at the University of Glasgow He left that post to take a job as private...
- 20
- 695
- 0
Báo cáo khoa học: A kinetic model for the burst phase of processive cellulases pptx
Ngày tải lên :
28/03/2014, 23:20
... Materials and methods All mathematical analysis and numerical tting were performed using the software package Mathematica 7.0 (Wolfram Research, Inc Champaign, IL, USA) The substrate in the calorimetric ... and off rate At a xed k2, a change in this ratio may be interpreted as a change in the afnity of the enzyme for the substrate Hence, we can assess relationships of this afnity parameter and the ... examples of how the analysis of the kinetic parameters may elucidate certain aspects of the activity of Cel 7A First, we consider changes in the ratio k1S0 k3 This reects the ratio of the on rate...
- 14
- 572
- 0
THE FIRST EIGENVALUE OF p-LAPLACIAN SYSTEMS WITH NONLINEAR BOUNDARY CONDITIONS D. A. KANDILAKIS, M. pptx
Ngày tải lên :
23/06/2014, 00:20
... author acknowledges support by the Operational Program for Educational and Vocational Training II (EPEAEK II) and particularly by the PYTHAGORAS Program no 68/831 of the Ministry of Education of the ... Aegean under the Project EPEAEK II-PYTHAGORAS with title “Theoretical and Numerical Study of Evolutionary and Stationary PDEs Arising as Mathematical Models in Physics and Industry.” The third author ... Equations 1998 (1998), no 10, 1–13 R E Showalter, Monotone operators in Banach space and nonlinear partial differential equations, Mathematical Surveys and Monographs, vol 49, American Mathematical...
- 15
- 257
- 0
Báo cáo toán học: "A Note on the First Occurrence of Strings" ppsx
Ngày tải lên :
08/08/2014, 01:20
... two players choose any pair of complement strings (except for the pair 11 10 and 00 01), then the third player can always attain an advantage by choosing a particular string Before we proceed, ... has the same or better chance of occurring before σ1 and σ2 Proof The proof can be shown in a similar fashion to that of Theorem 2, so it is omitted Remark It should be noted that the inequalities ... independently and randomly from {0, 1} The winner of the game is the player whose selected string appears first This problem has been formulated as a game or studied as a classical probabilistic problem...
- 8
- 431
- 0
báo cáo khoa học: "Two successful pregnancies in a woman with chronic myeloid leukemia exposed to nilotinib during the first trimester of her second pregnancy: case study" potx
Ngày tải lên :
10/08/2014, 22:20
... supervisor of clinical management of the patient and interpretation of data All authors read and approved the final manuscript Consent Written informed consent was obtained from the patient for publication ... http://www.jhoonline.org/content/2/1/42 Therefore, imatinib was permanently withdrawn Consequently, the patient was treated with interferon alfa- 2a at a dose of million IU daily After year of IFN-based therapy, complete HR was achieved ... interests The authors declare that they have no competing interests Authors' contributions MC was responsible of the clinical management of the patient, acquisition of data, drafting the manuscript;...
- 4
- 286
- 0
báo cáo khoa học: "Acute abdomen due to spontaneous splenic rupture as the first presentation of lung malignancy: a case report" ppsx
Ngày tải lên :
10/08/2014, 23:20
... significant mediastinal adenopathy and a cm upper right paratracheal node Pneumococcal and meningococcal vaccines were administered and our patient was then promptly taken to theater for laparotomy ... examination of her internal organs at laparotomy, other than hemorrhage and rupture of her spleen, there was no other gross abnormality and no evidence of disease in her other intraabdominal ... of a lack of trauma The exact pathophysiology that links lung cancer with SSR (in the absence of splenic metastasis or use of chemotherapy or pegfilgrastim) remains unclear The possible explanations...
- 4
- 347
- 0
Báo cáo khoa hoc:" Seizures as the first manifestation of chromosome 22q11.2 deletion syndrome in a 40-year old man: a case report" doc
Ngày tải lên :
11/08/2014, 10:22
... patient, demonstrating basal ganglia and periventricular calcification Brain computer tomography cuts of the patient, demonstrating basal ganglia and periventricular calcification Page of (page number ... DiGeorge/velocardiofacial syndrome critical region TUPLE (HIRA) probe was labeled in Spectrum Orange and Arylsulfatase A (ARSA) in SpectrumGreen as control Absence of the orange signal indicates deletion of ... deletion of the TUPLE locus at 22q11.2 ARSA signals All metaphase and interphase cells analyzed show a deletion of TUPLE1 at 22q11.2 locus The patient was treated with calcium citrate and calcitriol...
- 5
- 254
- 0
Báo cáo y học: " The first description of severe anemia associated with acute kidney injury and adult minimal change disease: a case report" ppsx
Ngày tải lên :
11/08/2014, 19:21
... reviewed the content of the paper EF interpreted patient data and the literature and critically reviewed the content of the paper All authors read and approved the final manuscript Acknowledgements The ... interpreted patient data, identified the unusual nature of the case, advised on content of the paper and critically reviewed the content of the paper NG provided clinical information and critically reviewed ... initiated on Day one of hospitalization Prednisone therapy was initiated on Day eight The hematocrit percentages and creatinine levels were measured at the indicated days The changes in hematocrit...
- 6
- 316
- 0
Báo cáo y học: "The first report of human illness associated with the Panola Mountain Ehrlichia species: a case report" doc
Ngày tải lên :
11/08/2014, 23:21
... report that an emerging pathogen, the Panola Mountain Ehrlichia species, was detected in blood from a human patient following the bite of a nymphal Amblyomma that was probably acquired at Panola Mountain ... September was unremarkable Pyrexia was not observed and no erythema or edema was noted at the site of the tick bite; however, the patient had taken 500 mg aspirin prior to examination The patient was ... Panola Mountain State Park in Georgia in the United States of America The Panola Mountain Ehrlichia species was originally described from a goat fed upon by A americanum collected at this park [4],...
- 3
- 285
- 0
Báo cáo y học: " Induction of the HIV-1 Tat co-factor cyclin T1 during monocyte differentiation is required for the regulated expression of a large portion of cellular mRNAs" pptx
Ngày tải lên :
13/08/2014, 09:20
... responsible for the pattern observed in the dendrogram, a two-way ANOVA was fit to each probeset using activation and knockdown state as explanatory variables A linear contrast analysis was then performed ... Validation of the microarray data Validation of the microarray data Cell cultures were infected with indicated shRNA lentiviral vectors for five days, treated with PMA for 24 hours, and total ... for the appropriate expression of a sizable portion of mRNAs regulated by PMA In our transcriptional profiling data, PMA treatment and cyclin T1 knock-down are two major variables in the RNA samples...
- 16
- 178
- 0
Báo cáo y học: " The establishment and characterization of the first canine hepatocellular carcinoma cell line, which resembles human oncogenic expression patterns" ppsx
Ngày tải lên :
13/08/2014, 13:20
... Tm AGCTTGCTGGTGAAAAGGAC TTATAGTCAAGGGCATATCC GATATCGCCGCGCTCGTCGTC GGCTGGGGTGTTGAAGGTCTC TGTGCTGTGAAATCCCTGAATAGAATC CCAAGAGTGAGAGTACGTTTGGATGAC AGATGTTAGTGACAATGAACCT GTGATTTGTGTGTGCTGATC CGGAGGGACGCCAAACAGG ... canine c-MET.seq c-MET human.seq GGCACCCTAGAGCTGAACTGCGCCCATCTTTTTCTGAACTGGTCTCCAGGATATCAGCAA GGCACCCTAGAGCTGAACTGCGCCCATCTTTTTCTGAACTGGTCTCCAGGATATCAGCAA GGCACCCTAAAGCCGAAATGCGCCCATCCTTTTCTGAACTGGTGTCCCGGATATCAGCGA ... CGGAGGGACGCCAAACAGG GTCCCGGGTCAACTCTTCGTG TGGAGAGCGTCAACCGGGAGATGT AGGTGTGCAGATGCCGGTTCAGGT ATGGGTAGGGCAAATCAGTAAGAGGT AAGCATCGTATCACAGCAGGTTAC CCGCCTTGGTGGTGGTCTCC AGGGCGCTGGGCTTCTCGT ACACCAGCCTGCGCCTCAAGACCT...
- 10
- 336
- 0
Báo cáo y học: "Human embryonal epithelial cells of the developing small intestinal crypts can express the Hodgkin-cell associated antigen Ki-1 (CD30) in spontaneous abortions during the first trimester of gestation" ppsx
Ngày tải lên :
13/08/2014, 22:22
... section The counted areas were selected from random tissue sections, taking into account that the ratio of the area of the intestinal stroma to the area of surface epithelium Page of (page number ... activated lymphocytes The identification of this antigen in cells as apparently disparate as activated lymphocytes, R-S cells and now human epithelial cells of the developing fetal intestinal crypts ... serum An anaplastic lymphoma case-slide (positive control) was run in parallel with the assay Analysis of CD30/Ki-1 positive cryptae cells For each sample, the CD30/Ki-1 positive population was assessed...
- 6
- 238
- 0
Báo cáo y học: "Risk assessment in the first fifteen minutes: a prospective cohort study of a simple physiological scoring system in the emergency department" ppsx
Ngày tải lên :
14/08/2014, 07:21
... Pittard AJ: Out of our reach? Assessing the impact of introducing a critical care outreach service Anaesthesia 2003, 58:882-885 19 DeVita MA, Braithwaite RS, Mahidhara R, Stuart S, Foraida M, ... LMe, LMa and JT participated in the design of the study DB designed the study database RE, DB, LMe and LMa collected all data on ED patients TM and DB performed the statistical analysis The manuscript ... complete data were collected on the study forms Ethical approval and patient consent The study was approved by the Ethical Committee of the Canton of Bern, and adheres to the tenets of the Declaration...
- 9
- 416
- 0