biomarkers surrogate endpoints and clinical endpoints in the development of cardiovascular drugs a regulatory perspective
Assessment of weed management practices and problem weeds in the midsouth united states—soybean a consultants perspective
... amaranth in Arkansas (Arkansas soybean growers personal communication), and total hand-weeding cost can vary based on the level of infestation and the frequency of hand-weeding Palmer amaranth ... Louisiana In contrast, 72% of Table Area under different frequencies of Palmer amaranth hand-weeding in Louisiana and remaining midsouth (data pooled for Arkansas, Mississippi, and Tennessee) Hand-weeding ... scouted in Louisiana and the remaining midsouth, respectively (Table 6) On average, hand-weeding added an additional US$46 and US$59 haÀ1 to soybean-production input costs in Louisiana and the remaining...
- 12
- 556
- 0
báo cáo hóa học: " Relationship between the EQ-5D index and measures of clinical outcomes in selected studies of cardiovascular interventions" pot
... read and approved the final manuscript Additional material Additional file Canadian Cardiovascular Society (CCS) angina and New York Heart Association (NYHA) functional capacity and objective assessment ... acceptance on to the transplant list, implant with a VAD, or Tx, was used Statistical analysis The EQ-5D index and other continuous variables were summarized using the mean and standard deviation and ... index for a ten year increase in age, males versus females, a one minute increase in ETT, a one class increase in CCS, a 10 unit increase in the SAQ scales and a 0.1 unit change in SF-6D as these...
- 14
- 610
- 0
Báo cáo y học: " Role of clinical bioinformatics in the development network-based Biomarkers" docx
... reach clinical application, the advantages and disadvantages of protein-based network biomarkers should be furthermore investigated to evaluate the potential values of network biomarkers in the ... optimize the development of disease-specific biomarkers and supervise drug target identification and clinical validation [6] Understanding the interaction between clinical informatics and bioinformatics ... predicting the occurrence of diseases One of the most challenges is to translate biomarkers into clinical application and validate the disease specificity Dynamic network biomarkers have the advantage...
- 9
- 265
- 0
Globalization and its effects on the development of educational service in Vietnam
... adapting new global value chains As analyzed, global value chains in Vietnam often base on cheap-salaried workers and varied other resources Participating into those chains, Vietnam has obtained ... produced in China, other auxiliary materials are made in India And the final stage of products is made in countries with low labor costs such as Vietnam, China, Cambodia 2.1.4 The impact of adhering ... participate in the globalization of services production Arora and Gambardella (2004) examine the expansion of the software industry in India, Ireland, Israel and Brazil The growth in the first...
- 63
- 995
- 3
Tài liệu Báo cáo khoa học: High affinity copper binding by stefin B (cystatin B) and its role in the inhibition of amyloid fibrillation docx
... protein, lacking the copper binding domain is capable of domain swapping and forms a dimer as revealed by crystal structure analysis [36] In our case, SEC data collected for samples at pH have ... binding Experiments were carried out at either pH or pH using mM Mes as a buffer Shown are stefin A and stefin B at pH and variant of stefin B and the P79S mutant of the variant at both pH and pH Each ... corresponding to the heat change (lcalÆs)1) with each injection The bottom panel is a plot of heat change on ligand addition (kcalÆmole)1) against the ligand ⁄ stefin molar ratio The background heat change...
- 14
- 586
- 0
Tài liệu Báo cáo khoa học: Inorganic pyrophosphatase in the roundworm Ascaris and its role in the development and molting process of the larval stage parasites doc
... containing an XhoI (Promega) site upstream of the start codon and an antisense primer (5¢-CAGCCAA GCTTCTCACTCTTTGATGAAATGCATCT-3¢) containing a HindIII (Promega) site just downstream of amino acid ... to the calculated mass of the AdR44 cDNA (data not shown) The functional activity of the purified rAsPPase was determined using a PPi hydrolysis assay in a standard reaction mixture containing ... slaughterhouse in Shimotsuma, Japan Adult A lumbricoides and T canis were obtained from patients after treatment with piperazine in Bac Gian, Vietnam and, from an infected dog in Miyazaki, Japan, respectively...
- 13
- 691
- 0
Báo cáo khoa học: Roles of the SH2 and SH3 domains in the regulation of neuronal Src kinase functions pptx
... from their auto-inhibitory positions at the back site of the kinase domain, adopting an extended conformation and stimulating the catalytic activity of the kinase [32] Small-angle X-ray scattering ... application of SH2 domain binding peptides, which results in blocking of the binding of the SH2 domain to the substrate and thereby preventing interaction of the substrate with the kinase domain For active ... preventing it from reverting to the auto-inhibitory state [33] In Src and Abl kinases, the SH2 domain can act in conjunction with an additional SH2 or SH3 domain to maintain an inactive state through...
- 11
- 597
- 0
AN ACCOUNT OF TIMBUCTOO AND HOUSA, TERRITORIES IN THE INTERIOR OF Africa docx
... Country.-Dar El Beida, Fedalla, and Rabat described. Mausoleum of the Sultan Muhamed ben Abd Allah at Rabat. Of Sheila, a Roman Town. Of the Tower of Hassan. Road of Rabat. Productive Country about Rabat. ... Tildie.-Arab Repast there. Natural Strength of Santa Cruz, of the Town of Agurem, and the Portuguese Spring and Tank there. Attempt of the Danes to land and build a Fort.-Eligibility of the Situation ... the city of Terodant and the port of Santa Cruz There is an emigration of the Mograffra Arabs, who are in possession of the country between Terodant and the port of Messa The encampments of an...
- 387
- 381
- 0
Báo cáo khoa học: Relationship between functional activity and protein stability in the presence of all classes of stabilizing osmolytes ppt
... lysine, b-alanine, taurine and dimethylglycine have not been published elsewhere We have therefore measured the thermodynamic parameters of RNase -A in the presence of these amino acids and amino ... xylitol, adonitol, mannitol) and amino acids and derivatives (glycine, alanine, proline, serine, lysine, b-alanine and taurine) that have no significant effects on both DGD° and kcat (b) Class II ... compilation ª 2009 FEBS S Jamal et al the analysis of the progress curves for kinetic parameters are accurate It can be seen in Fig (see also Table 1) that sugars and methylamines affect both the thermodynamic...
- 9
- 547
- 0
Báo cáo Y học: Inhibition of the SERCA Ca21 pumps by curcumin Curcumin putatively stabilizes the interaction between the nucleotide-binding and phosphorylation domains in the absence of ATP pot
... both Ca2þ (Fig 3A) and ATP (Fig 3B) in the absence and presence of curcumin, using the coupled enzyme assay In Fig 3A, the half-maximal activation of the ATPase by Ca2þ was measured in the absence ... [32P]ATP in the absence of Ca2þ (Fig 4A) The data showed that the amount of ATP bound to the ATPase was reduced by curcumin The binding inhibition had a apparent Ki (IC50) of about mM Reversing the ... curcumin can ‘occlude’ ATP binding, in the same way as chromium-ATP, by trapping the ATP in the binding site when the two domains come together [44], as our ATP binding data shows that little ATP...
- 10
- 594
- 0
corporate social responsibility strategies for sustainable development for small and medium enterprises in the village of bac ninh province, vietnam
... is of paramount importance Models of sustainable development in Vietnam is formed on the basis of empirical research and, in accordance with the actual and desired by local managers 1.3 Small and ... in the village of BacNinh province, Vietnam The research applied the theories and models to analyze and assess the actual situation of production and business of small and medium enterprises in ... of Bac Ninh, the major figures of handicrafts, the report evaluating the production and trading of small and medium enterprises in the village of Bac Ninh 3.3 The scope of research To systematize...
- 69
- 577
- 0
Postal Savings and the Provision of Financial Services: Policy Issues and Asian Experiences in the Use of the Postal Infrastructure for Savings Mobilization pdf
... Japan and the Republic of Korea; 3) the linkage of savings to a postal payments system, as proposed in Kazakhstan and other CIS States; and 4) the national savings bank use of the postal infrastructure, ... services after privatization of postal savings This has been the case in Asia as well, whether the savings facility takes the form of a national savings organization (NSO), as in Bangladesh and India, ... organization for providing savings services through the postal infrastructure in Asia: 1) the national savings organization, as in Bangladesh and India; 2) the postal savings bureau, as in China,...
- 38
- 645
- 3
Surfing the waves of globalization - Asia and financial lobalization in the context of the trilemma
... tài Bài nghiên cứu ‘’Surfing the Waves of Globalization: Asia and Financial Globalization in the Context of the Trilemma’’ Joshua Aizeman cộng (2010) cho thấy nhìn ba sách Do đó, phạm vi tiểu ... vectơ hai số ba số ba bất khả thi, là, MI (monetary independence - độc lập tiền tệ), ERS (exchange rate stability – ổn định tỉ giá), KAOPEN (financial openness – hội nhập tài chính) Aizenman cộng ... ý ngh a Easterly et al (2001) Rodrik (1998) Đối với biến động làm giảm hiệu mở c a thương mại, tham khảo Calvo et al (2004), Cavallo (2005, 2007), Cavallo Frankel (2004) Tác động mở c a thương...
- 28
- 682
- 0
Water pollution and habitat degradation in the Gulf of Thailand ppt
... Menasveta and Cheevaparanapiwat (1982) Cheevaparanapiwat and Menasveta (1979) Menasveta and Cheevaparanapiwat (1981) in fish caught from the natural gas production area and the coastal area, including ... 1984–1986 Bang Pra Coast Inner Gulf Inner Gulf Inner Gulf Chao Phraya Estuary Estuarine areas Estuarine areas Mae Klong Ta Chin Chao Phraya Bang Prakong Bang Prakong Estuary East coast of the Inner ... pesticides, PCB and certain heavy metals in fish and shellfish from Thai coastal and inland waters Arch Fisch Wiss 2, 109–122 Jarach, W., 198 7a Heavy metals in seawater of the Upper Gulf of Thailand In: Proceedings...
- 9
- 499
- 0
Báo cáo khoa học: Soluble recombinant CD69 receptors optimized to have an exceptional physical and chemical stability display prolonged circulation and remain intact in the blood of mice doc
... 5¢-ACAAAGCTTATTTGTAAGGTTTGTTACA-3¢; for CD69NV82, 5¢-ACATATGGTTTCTTCATGCTCTG-3¢ and 5¢- ACAAAGCTTATTTGTAAGGTTTGTTACA-3¢; and for CD69NS84, 5¢-ACATATGTCATGCTCTGAGGACTGG GTT-3¢ and 5¢- ACAAAGCTTATTTGTAAGGTTTGTT ACA-3¢ ... Vent DNA polymerase (NEB, Ipswich, MA, USA) as the amplification enzyme, pCDA401 as a template and the following primer pairs: for CD69NG70, 5¢-ACATATGGGCCAATACACATTC-3¢ and 5¢-ACAAAGCTTATTTGTAAGGTTTGTTACA-3¢; ... with the concomitant increase in the molar extinction coefficient of the protein, and thus the increase in absorbance in the aromatic region Shortly thereafter, a gradual unfolding of the protein...
- 18
- 400
- 0
Making the Poor Pay for Public Goods via Microfinance Economic and Political Pitfalls in the Case of Water and Sanitation docx
... via Microfinance: Economic and Political Pitfalls in the Case of Water and Sanitation Introduction: Radicalised microfinance Microfinance is increasingly promoted by foundations and international ... definition incapable, and aid and tax transfers will naturally decline over time; fragmented and individualistic business approaches, on the other hand, are seen as having the capacity both to attract ... for Water and Sanitation: Lofty Dream or Wave of the Future? In: Microfinance Focus, 30 May 2011. Kabir, Ashfanoor/Himadri Shekhar Dey/Hasan Faraby, 2010: Microfinance: The Sustainable Financing...
- 43
- 464
- 0
Accuracy of Clinical Signs in the Diagnosis of Pulmonary Tuberculosis: Comparison of Three Reference Standards Using Data from a Tertiary Care Centre in Rwanda doc
... fits the data It indicates the amount of the relationship between the variables that remains unexplained by a model; the larger the value, the poorer the model fits the data As a rule of thumb, a ... questionable, another series of three sputa was performed All clinical and laboratory testing was part of routine examination For HIV testing, specific informed consent was asked and counseling offered ... cavities and unilateral apical infiltrates, haemoptysis and cavities, and unilateral apical infiltrates and fever This model provided significant better fit to the data than model Model is a...
- 7
- 506
- 0
Consumer market study on the functioning of e-commerce and Internet marketing and selling techniques in the retail of goods potx
... time, taxes, and availability of products There is a lack of clarity and choice about default rankings; and importantly a lack of information about payments for ranking placements and listings Other ... between Belgium and the Netherlands, and the Netherlands and Germany (5) Many consumers research information on products and prices offline and then buy them online: Nearly one in five online shoppers ... quarter of respondents in Greece, Spain, Portugal and Slovenia are afraid of the misuse of their personal and payment details Around 20% of respondents in Denmark, Finland and Slovenia prefer to have...
- 223
- 1,655
- 0
Báo cáo khoa học: Characterization of Trypanosoma brucei PEX14 and its role in the import of glycosomal matrix proteins pptx
... that the number of cells increased again after days (see Fig 3A) Indeed, the spontaneous development of such RNAi revertants has been observed by us and others also in other cases and appears ... were incubated for at concentrations of digitonin as indicated The release of PYK, ALD, GAPDH and TIM from the cells was assayed after centrifugation of the treated cell suspensions and the preparation ... in various yeasts, mammalian cells and plants as a component of the docking complex and a point of convergence of the PEX5- and PEX7-dependent import pathways [15–17] The N-terminal part of PEX14...
- 9
- 549
- 0
Báo cáo khoa học: Functionally distinct dopamine and octopamine transporters in the CNS of the cabbage looper moth* potx
... performed using single-stranded cDNA from caterpillar heads as template with primers designed from the amino acid sequences of mammalian GABA transporters (GABA1:NVWRFPY) and mammalian dopamine transporters ... (CaeDAT, Q03614), zebrash (DarDAT, AAK52449), and human (hDAT, AAA19560) The cDNA sequence was found to contain an ORF of 1839 bp encoding a potential 612 amino acid protein The putative translational ... AngSERT, EAA05837), nematode (CaeDAT, Q03614; CaeSERT, AAK84832), sea hare (ApcSERT, AAK94482), bullfrog (RacET, AAB67676), zebrash (DarDAT, AAK52449), and human (hDAT, AAA19560; hSERT, AAA35492;...
- 11
- 431
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25