biological fe demand in brown versus clear water systems
Children’s Health Deficits due to Diarrhoea: Effects of Water Supply and Sanitation Systems in Slums with Different Water Logging Conditions
... children defecating in open field Households with children defecating in room Households with children defecating in verandah Households with children defecating in latrine defecating in latrine Households ... lower household income, not using a tap water supply, using an overhead latrine or not having a latrine, not filtering or boiling water, no water treatment procedures, defecating in open field ... types of inundation (rainy, stagnant -water, heavy-rainy, monsoon-flood and drainage -water inundations) Ten subdistricts were selected by integrating information regarding water logging for the...
- 15
- 702
- 0
Occurrence of Tetracycline-Resistant and Tetracycline- Degrading Bacteria in Wastewater Treatment Plant Effluent and Environmental Water Systems
... stored in an ice box or in a refrigerator maintained at 4°C We started the experiment within 24 h of sampling Tetracycline hydrochloride (Tokyo Chemical Industry, Japan) was dissolved in predetermined ... tetracycline-degrading bacteria in Tedori River and wastewater treatment plant effluent but not sufficient in Unoke River and rain water The bacterial density in the water samples before and after incubation ... Unoke River water samples with 60% degradation in the sample with the initial tetracycline concentration of mg/L (2) Not all bacteria growing in the water environment containing tetracycline were...
- 7
- 546
- 0
A STUDY OF LINGUISTIC FEATURES OF THE NAMES OF COFFEE SHOPS IN ENGLISH VERSUS VIETNAMESE
... found out the distinctive stylistic devices features using in advertising of two languages in newspapers Moreover, Hoang Kim Anh in “An Investigation into Stylistic Devices Using In Proverbs” The ... Names of Coffee Shops in English Versus Vietnamese a Morphological Features of the Names of Coffee Shops in English • Clipping in the Names of Coffee Shops According to Wikipedia, clipping is the ... Describe the semantic features of names of coffee shops in English and Vietnamese - Find out the similarities and differences in the linguistic features of names of coffee shops in English and Vietnamese...
- 43
- 1,017
- 0
A study of pre sequences in announcements in english versus vietnamese
... Checking Pre-knowledge + Checking 56 28 b Checking Pre-action + Showing pity 12 c Checking Condition + Showing necessity 4.5 + Showing wishes 13 6.5 + Ordering 11 5.5 200 100 4.2.1.7 Showing pity ... S’s main intention is to achieve success in giving the news to the recipient 4.2.2 Pragmatic Features of PAs in Vietnamese 4.2.2.1 Getting Attention of the Hs 4.2.2.2 Confirming a Confirming Personal ... quite different This means that the differences between PAs in English and Vietnamese English and Vietnamese intentions in using PAs are quite different 5.2 BRIEF RE-STATEMENT OF THE FINDINGS 4.3...
- 13
- 755
- 0
A study of linguistic features of real estate advertisements in english versus vietnamese
... want to live in the centre all in real estate for sale, for rent as well as for investment, Meanwhile, in Vietnam, big cities are the ideal destination for living, entertaining and business On the ... real estate advertisements An investigation into linguistic features of a discourse is not new, but the investigation into linguistic features of real estate advertising is rather new This thesis ... major field in the economy but is disregarded in advertising field to some extent 5.3 LIMITATIONS In spite of the fact that we have tried our best in finding materials and investing our efforts,...
- 13
- 682
- 0
A study of linguistic features of proverbs expressing richness and poverty in english versus vietnamese
... Vietnamese in terms of syntactic and semantic features - Comparing to find out the similarities and differences in proverbs expressing richness and poverty in terms of these features CHAPTER FINDINGS ... Describing and analyzing proverbs expressing richness and poverty in English in terms of syntactic and semantic features - Describing and analyzing proverbs expressing richness and poverty in Vietnamese ... purpose of doing a research into the linguistic linguists such as Neal (1985), Stephen (1998), Wolfgang (2004)… features of proverbs expressing richness and poverty in English Vs Different researchers,...
- 13
- 1,304
- 1
A study of linguistic features of proverbs containing weather terms in english versus vietnamese
... inspiration that I feel something meaningful should be done, rather title “A Study of Linguistic Features of Proverbs Containing than just show admiration to this invaluable treasure Hence, in ... semantic kind of proverbs that contains such weather terms as rain, wind, features of proverb containing weather terms, which offer didactic storm, lightning, snow, etc messages, advice, and meaningful ... features of different That is an interesting issue which interests many proverbs containing weather terms in English Versus (Vs.) researchers among whom I am not an exception Vietnamese In addition,...
- 13
- 806
- 1
A study of attitudinal disjuncts in english versus vietnamese
... modulating the speaker’s or writer’s claim, especially, when transmitting a thought, manifesting an intention or displaying information If placed in wrong position, ADs may create a misunderstanding ... Adverbial Marking Stance was defined within three major domains: Epistemic stance, Attitudinal stance, and Style stance In the reality of the increasing needs for communication, ADs are becoming one ... in keeping softening critism + + the face of S and H - High ADs in boosting - Low ADs in in saving S’s face by avoiding imposing + + the objection the knowledge 19 20 4.3.3.2 Differences between...
- 13
- 617
- 0
A discourse anslysis of the linguistic features of the advertisements of food and drink in english versus vietnamese
... Advertising Discourse Advertisements as a genre have their distinctive linguistic features which are manifested in the manipulation of language for the sake of informing and persuading Advertising ... Addressee Conative (influencing behaviour of addressee) 3.2 DATA COLLECTION World Referential (imparting information) 3.2.1 Sampling Channel Phatic (checking or establishing contact) Two main types: long ... found instances of the use of words that rhyme in poetry or songs/jingles We can see the rhyme between the word at the end of one line with that in the next line: Rhyming [u:], Rhyming [@U], Rhyming...
- 13
- 1,535
- 1
A study of attitudinal disjuncts in english versus vietnamese
... modulating the speaker’s or writer’s claim, especially, when transmitting a thought, manifesting an intention or displaying information If placed in wrong position, ADs may create a misunderstanding ... Adverbial Marking Stance was defined within three major domains: Epistemic stance, Attitudinal stance, and Style stance In the reality of the increasing needs for communication, ADs are becoming one ... in keeping softening critism + + the face of S and H - High ADs in boosting - Low ADs in in saving S’s face by avoiding imposing + + the objection the knowledge 19 20 4.3.3.2 Differences between...
- 13
- 1,301
- 0
A contrastive study of linguistic features of idioms expressing distance in english versus vietnamese
... opposite daily life because they go with daily activities, status or feeling of principles in everything for example good and evil, Yin and Yang, human beings, things surrounding people And idiom ... meaning : to live extremely far away from a place similarities and differences in the linguistic features of idioms from the meaning of separate words Another illustrating example in expressing ... difference or Expressing Distance in English versus Vietnamese for similarities disagreement It partly involves the perceived differences and and differences based on their cultural underlying features...
- 13
- 997
- 1
CHAPTER 8 Consumer Choice and Demand in Traditional and Network Markets
... good or service for which demand rises with an increase in income and falls with a decrease in income The demand for a few luxury goods actually outstrips increases in income A luxury good or service ... differently in different markets Beans may be an inferior good to most low-income consumers and a normal good to many others For example, how you think a change in income will affect the demand ... less, point a is preferable to point c, and point b is preferable to point a If a is preferable to demand but e is preferable to a, then when we move from point d to e, we must move from a combination...
- 50
- 499
- 0
![Tài liệu Báo cáo khoa học: Expression of two [Fe]-hydrogenases in Chlamydomonas reinhardtii under anaerobic conditions doc](https://media.store123doc.com/images/document/14/br/hw/small_hwm1392870031.jpg)
Tài liệu Báo cáo khoa học: Expression of two [Fe]-hydrogenases in Chlamydomonas reinhardtii under anaerobic conditions doc
... distinctive structural features of algal [Fe] hydrogenases are also present in the C reinhardtii HydA2 amino-acid sequence [33–35], including the well-conserved C-terminal part (C-domain) that binds ... after anaerobic induction There is precedence for multiple [Fe] -hydrogenases in different organisms, and the presence of multiple hydrogenases (both [Fe] and [NiFe]) involved in different metabolic ... H-cluster As seen in other algal [Fe] -hydrogenases, the N-terminal part (F-domain) of HydA2 also lacks the additional [ 4Fe- 4S] or [ 2Fe- 2S] centers (F-cluster) found in nonalgal [Fe] hydrogenases...
- 9
- 451
- 0
Tài liệu Báo cáo khoa học: Mosquito (Aedes aegypti ) aquaporin, present in tracheolar cells, transports water, not glycerol, and forms orthogonal arrays in Xenopus oocyte membranes docx
... would be interesting to test if AeaAQP is simultaneously expressed in these serotonin receptorexpressing tracheolar cells and if serotonin is in any way involved in modulating water transport in tracheolar ... proposing that changes in tissue osmotic pressure are associated with rapid water movement in tracheoles supplying tissues with different oxygen demands during activity or rest This movement of water ... cDNA showed that in nonblood-fed females this aquaporin mRNA is also transcribed in the head (2–6-dayold females) and hindgut (5–10-day-old females) (not shown) Oocyte swelling assays Figure...
- 8
- 423
- 0
Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units doc
... and dwindling immigration) and an increase in overall workload demand (particularly in obstetric anesthesia) [1] Obstetric anesthesia workload in Israel has increased due to both an increase in ... anesthesia staffing ratios will need to use the OAAI, or a similar index, as a single workload denominator Competing interests There are no competing interests declared for any author Author information ... 18:130–45 Cohain JS: Midwifery in Israel Midwifery Today Int Midwife 2004, 71:50–1 4 Weiniger CF, Ivri S, Ioscovitch A, Grimberg L, Evron S, Ginosar Y: Obstetric anesthesia units in Israel: a...
- 14
- 610
- 0
Ambient particulate air pollution induces oxidative stress and alterations of mitochondria and gene expression in brown and white adipose tissues ppt
... long chain fatty acids (Elovl3), type iodothyronine deiondinase (Dio2), homeobox C9 (Hoxc9), insulin-like growth factor binding protein (Igfbp3), dermatopontin (Dpt), and b-actin are showed in Table ... TGCCATAAACTTCCACATCCT b-actin TGTGATGGTGGGAATGGGTCAGAA TGTGGTGCCAGATCTTCTCCATGT peroxidase After rinsing in phosphate buffered saline (PBS), the sections were incubated in 1% BSA/PBS for 10 minutes, followed ... deviation inflammatory response and IR development, were examined in mice As shown in Figure 3, PM 2.5 exposure induced a marked increase in macrophage (F4/80+ cells) infiltration in eWAT Next,...
- 14
- 466
- 0
Báo cáo khoa học: Mass spectrometric characterization of the covalent modification of the nitrogenase Fe-protein in Azoarcus sp. BH72 ppt
... modified Fe- protein, providing evidence that nitrogenase Fe- protein indeed is modified by ADP-ribosylation, resulting in the observed migration difference during 2D gel electrophoresis Another striking ... colloidal Coomassie staining solution [36]; (c) a zinc-imidazole stain [37]; and (d) a copper stain [38], as well as their impact on the further processing of proteins by MS In all staining methods, except ... arginine of dinitrogenase reductase in Azoarcus sp BH72 In an Azoarcus point mutation strain BHnifH_R102A, no modified NifH protein was observed during a western blot analysis of total protein...
- 10
- 414
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008