bidyanus bidyanus over wintering fingerlings in a tank based recirculating aquaculture system

Báo cáo khoa học: "User Expertise Modelling and Adaptivity in a Speech-based E-mail System" doc

Báo cáo khoa học: "User Expertise Modelling and Adaptivity in a Speech-based E-mail System" doc

Ngày tải lên : 23/03/2014, 19:20
... investigate adaptivity in spoken dialogue systems in order to enable users to interact with the speech -based systems in a more flexible and natural way The practical goal of AthosMail is to give an ... naturalness and appropriateness of each system utterance, as well as provide any other comments that they may have on adaptation and adaptive systems All interviewees agreed on one major theme, namely ... Message length 24 lines U: Read Sakari Rantala's message S: Third message, from Sakari Rantala, about Re: Comments about the draft [reads the message] Message read You are in the first message...
  • 8
  • 420
  • 0
Volatile Organic Compound Concentrations and Emission Rates Measured over One Year in a New Manufactured House pptx

Volatile Organic Compound Concentrations and Emission Rates Measured over One Year in a New Manufactured House pptx

Ngày tải lên : 22/03/2014, 14:20
... weekly, and the valves were adjusted as required to maintain constant rates The sampling and analytical process was computer controlled TVOC was determined as the sum of all chromatographic peaks in ... with age and in the house parameters, principally air change rate, temperature and relative humidity Air change rates in the house, which was operated at a single defined condition for all the sampling ... the HAC fan was operated continuously with the outdoor air intake sealed, and the indoor temperature was maintained by thermostatic control of the heating or air conditioning equipment Air samples...
  • 34
  • 600
  • 0
Báo cáo y học: "Does an increase in body mass index over 10 years affect knee structure in a population-based cohort study of adult women" pot

Báo cáo y học: "Does an increase in body mass index over 10 years affect knee structure in a population-based cohort study of adult women" pot

Ngày tải lên : 12/08/2014, 14:22
... identification and time sequence Medial and lateral tibial plateau bone area was summed to obtain tibial plateau bone area CV have been assessed for the medial and lateral tibial plateau, and found ... pixels was also obtained [20] The assessment of cartilage defects Cartilage defects in the medial and lateral tibial femoral cartilages were graded on the MR images with a classification system as ... increase in BMI adjusted for age, tibial plateau area Odds of tibiofemoral cartilage defects per unit increase in BMI adjusted for age, tibial plateau area, and baseline BMI Odds of bone marrow...
  • 7
  • 255
  • 0
Tài liệu Báo cáo khoa học: "Multiple Default Inheritance in a Unification-Based" pdf

Tài liệu Báo cáo khoa học: "Multiple Default Inheritance in a Unification-Based" pdf

Ngày tải lên : 20/02/2014, 21:20
... Lexical entries are themselves classes, and any information they contain is standardly specific to an individual word; lexical and non-lexical classes differ in that analysis and generation take ... representing default information, which we refer to as the 'main' equation set These may be overridden by eontlleting information in a more specific class Each equation in a main set functions as an independent ... property m a y override another when assigned in a main equation set, but cause failure when assigned in a variant set Normally, variant sets are defined so as to be mutually exclusive; a FS that unifies...
  • 7
  • 362
  • 0
Báo cáo " A web-based decision support system for the evaluation and strategic planning using ISO 9000 factors in higher education " pot

Báo cáo " A web-based decision support system for the evaluation and strategic planning using ISO 9000 factors in higher education " pot

Ngày tải lên : 05/03/2014, 14:20
... and plan for a strategy in educational management of organizations in Vietnam and Asia [3] However, there are no DSS applications to apply a real case in the domain of an evaluation and a strategic ... strategic planning The final step is to build a Web -based DSS application based on AHP model for an evaluation and a strategic planning of a university Analytic Hierarchy Process (AHP), developed ... an evaluation and a strategic university planning For the implementation, a Web -based DSS is based on ISO 9000 factors for the evaluation and strategic planning for a case study of Vietnam National...
  • 12
  • 541
  • 0
Báo cáo khoa học: "Building trainable taggers in a web-based, UIMA-supported NLP workbench" potx

Báo cáo khoa học: "Building trainable taggers in a web-based, UIMA-supported NLP workbench" potx

Ngày tải lên : 16/03/2014, 20:20
... for (a) training and (b) tagging Machine learning components in Argo In order to ensure flexibility in building workflows, we split the machine learning capability into three distinct processing ... namely feature generator, model trainer and tagger The trainer and the tagger are intrinsic machine learning components, whereas the feature generator is a convenient and customisable processing ... recognition task at jnlpba In Proc of the International Joint Workshop on Natural Language Processing in Biomedicine and its Applications, JNLPBA ’04, pages 70–75, Geneva, Switzerland Association for...
  • 6
  • 320
  • 0
Báo cáo khoa học: "Evaluating Response Strategies in a Web-Based Spoken Dialogue Agent" pdf

Báo cáo khoa học: "Evaluating Response Strategies in a Web-Based Spoken Dialogue Agent" pdf

Ngày tải lên : 17/03/2014, 07:20
... train leaves at 3:00 pm on Saturday and StoMa), and it takes hour 12 rains The 2nd train leaves at 3:20 p m ever)' da3, and it takes I hour 22 rains The 3rd train leaves at 4:00 pm on Sunda), and ... seventh train leaves at 5:OOpm on Saturda); and it takes I hour 12 rains Please say "list" to hear trains at a time, or say "add constraint" to constrain your departure time or travel day, or say "continue" ... functionality, hints for talking to TOOT, and links to task pages Each task page contained a task scenario, the hints, instructions for calling TOOT, anal a web survey designed to ascertain the depart...
  • 7
  • 273
  • 0
A Practitioner’s Guide: To Economic Development Tools for Regional Competitiveness in a Knowledge-Based Economy pdf

A Practitioner’s Guide: To Economic Development Tools for Regional Competitiveness in a Knowledge-Based Economy pdf

Ngày tải lên : 17/03/2014, 10:20
... swift transformation taking place in the global economy makes occupation cluster analysis particularly valuable The global integration of markets has eliminated many regional competitive advantages ... coatings that provide wear-resistance and water-proofing for fabrics in apparel and textiles? Chances are, the people managing apparel and textile businesses in Brown County have no idea of what ... normally fail In contrast, public investments that are the product of open participation and strategic thinking can create sustainable transformations The Who: Building a Leadership Team Capable...
  • 19
  • 774
  • 0
Pastured Poultry Raising Chickens in a Grass-Based System docx

Pastured Poultry Raising Chickens in a Grass-Based System docx

Ngày tải lên : 17/03/2014, 10:20
... trailers as their place to roost • Could not be herded into the trailers easily – had to walk up narrow, steep ramp to access trailer doors • Had to be individually caught and manually placed inside ... http://www.motherearthnews.com/Real-Food/2007-1001/Tests-Reveal-Healthier-Eggs.aspx#ixzz27LvkfgLn Other Benefits of Pastured Poultry • Ethical concerns • Appealing appearance of flock to customers You’re not just marketing a product, you are marketing a way of life! Pastured ... advanced feathering – use feathering as a guide for decreasing temperature as the amount of feathering a chick has will dictate its cold-tolerance Look for signs of stress in the chicks to make sure...
  • 64
  • 272
  • 0
Báo cáo khoa học: "Performatives in a Rationally Based Speech Act Theory*" pptx

Báo cáo khoa học: "Performatives in a Rationally Based Speech Act Theory*" pptx

Ngày tải lên : 17/03/2014, 20:20
... the individual rational balance agents maintain among their beliefs, goals, intentions, commitments, and actions [2] As desiderata for the theory of performatives, we demonstrate that the analysis ... of declarative mood utterances, and then the illocutionary act definitions for requesting and asserting Finally, we combine the various analyses natural language processor's task by making explicit ... understanding, that is, to achieving a state of BMB that he is in a certain mental state Below is a definition of a speaker's requesting an addressee to achieve p Definition {REQUEST spkr addr...
  • 10
  • 288
  • 0
Báo cáo khoa học: "Multiple Interpreters in a Principle-Based Model of Sentence Processing" potx

Báo cáo khoa học: "Multiple Interpreters in a Principle-Based Model of Sentence Processing" potx

Ngày tải lên : 18/03/2014, 02:20
... relevant features (such as L-marking, Case, and 0) If we adhere to the representational paradigm used above, we can define Chains in the following manner: Chain Schevaa Node: C-Node: {Cat,Level,Pos,ID,Ftrs} ... a particular representation provides a formal characterisation of locality Just as phrase structure is defined in terms of branches, we can define Chains as a sequence of links More specifically, ... structures are limited to some combination of binary (non-terminal) and unary (terminal) branches As discussed above, we can characterise the representational framework in terms of nodes and schemas:...
  • 6
  • 364
  • 0
Báo cáo khoa học: "Modifying Beliefs in a Plan-Based Dialogue Model" ppt

Báo cáo khoa học: "Modifying Beliefs in a Plan-Based Dialogue Model" ppt

Ngày tải lên : 23/03/2014, 20:20
... listener can implicitly convey acceptance [2] by making an utterance which cannot be interpreted as initiating a negotiation dialogue Since both parties are engaged in a cooperative dialogue in which ... accept any claims that the speaker made or to initiate a negotiation dialogue Acceptance can be communicated in two ways Either the listener can explicitly indicate acceptance (e.g., "oh, alright"), ... unrelated to the original Obtain-Info-Ref, though still related to the problem-solving action of Instantiate-Var in order to build a plan to take CIS360 Since a new discourse plan is being pursued,...
  • 2
  • 298
  • 0
Báo cáo khoa học: "Correcting Errors in a Treebank Based on Synchronous Tree Substitution Grammar" pot

Báo cáo khoa học: "Correcting Errors in a Treebank Based on Synchronous Tree Substitution Grammar" pot

Ngày tải lên : 30/03/2014, 21:20
... errors in a verb modality corpus for machine translation with a machine-learning method ACM Transactions on Asian Language Information Processing, 4(1):18–37 Tetsuji Nakagawa and Yuji Matsumoto ... 1993 Building a large annotated corpus of English: the Penn Treebank Computational Linguistics, 19(2):310–330 Masaki Murata, Masao Utiyama, Kiyotaka Uchimoto, Hitoshi Isahara, and Qing Ma 2005 Correction ... translation In Proceedings of the 41st Annual Meeting of the Association for Computational Linguistics, Companion Volume, pages 205–208 Eleazar Eskin 2000 Detecting errors within a corpus using anomaly...
  • 6
  • 367
  • 0
Báo cáo khoa học: "FOCUS AND ACCENT IN A DUTCH TEXT TO-SPEECH SYSTEM" potx

Báo cáo khoa học: "FOCUS AND ACCENT IN A DUTCH TEXT TO-SPEECH SYSTEM" potx

Ngày tải lên : 01/04/2014, 00:20
... dominating unfocussed material are [-focus] In order to arrive at an accentuation pattern, three rules and a well-formedness condition are to be applied to this input A first rule (see (2)) applies ... arguments are normally labelled s and therefore likely to receive accent, there are some cases where we not want an argument to be accented A case in point are [-focus] pronouns In (Ta) we have ... element of a phrase will bear the accent when the phrase is in focus: after the application of focus assicmment and w/slabelling rules, an accent will be assigned to every terminal that is connected...
  • 5
  • 301
  • 0
báo cáo hóa học: " Initiation of health-behaviour change among employees participating in a web-based health risk assessment with tailored feedback" pptx

báo cáo hóa học: " Initiation of health-behaviour change among employees participating in a web-based health risk assessment with tailored feedback" pptx

Ngày tải lên : 20/06/2014, 00:20
... of a web -based HRA with tailored feedback at the workplace In the present study we evaluated initial health-behaviour change among employees who voluntarily participated in a web -based HRA including ... health-behaviour change in general, increase in physical activity and improved diet These findings may imply that the program is capable of stimulating health-behaviour change among those at ... change These findings indicate that among voluntary participating employees, a web -based HRA program with tailored feedback could motivate those in greatest need of health-behaviour change A...
  • 7
  • 538
  • 0
báo cáo hóa học:" Determinants of Treatment Access in a Population-based Cohort of HIV-positive Men and Women Living in Argentina" pdf

báo cáo hóa học:" Determinants of Treatment Access in a Population-based Cohort of HIV-positive Men and Women Living in Argentina" pdf

Ngày tải lên : 20/06/2014, 08:20
... (indinavir, saquinavir, lopinavir, atazanavir, or fosamprenavir) Statistical Analysis The first analysis evaluated participant characteristics associated with initiation of HAART Baseline variables ... randomized, doubleblind trial comparing combinations of nevirapine, didanosine, and zidovudine for HIV-infected patients: the INCAS Trial Italy, The Netherlands, Canada and Australia Study JAMA 1998, 279:930-937 ... initiate HAART at baseline are summarized in Table Compared with individuals who remained HAART-naive at baseline, those who initiated therapy were more likely to be older (P < 0001), have an...
  • 7
  • 398
  • 0
Teaching in a Web Based Distance Learning Environment: An Evaluation Summary Based on Four Courses pdf

Teaching in a Web Based Distance Learning Environment: An Evaluation Summary Based on Four Courses pdf

Ngày tải lên : 28/06/2014, 21:20
... heavy pages with appropriate formatting and images if appropriate General Findings The general findings and recommendations from the evaluation are: Finding 1: Instructors are generally motivated ... the appropriate use of internal hyperlinks and anchors so that the user can easily jump around within a page Maintain consistent organization of material Attempting to keep the format of assignments ... Four additional areas of general findings and recommendations are: Finding 1: Instructors are generally motivated to an excellent job of teaching in an online environment but are not always familiar...
  • 26
  • 219
  • 0
Critical Inquiry in a Text-Based Environment: Computer Conferencing in Higher Education pdf

Critical Inquiry in a Text-Based Environment: Computer Conferencing in Higher Education pdf

Ngày tải lên : 28/06/2014, 23:20
... below, and in much more detail in Archer, Garrison, and Anderson (199 9a) Oral and Text -based Communication Traditionally, educational interactions have been based upon oral communications between and ... states that the ``act of collaboration is an act of shared creation and/or shared discovery'' (p 4) Collaboration is an approach to teaching and learning that goes beyond simple interaction and ... of a community of inquiry such that coherence and meaning are apparent As essential as cognitive presence is in an educational transaction, individuals must feel comfortable in relating to each...
  • 19
  • 316
  • 0
Báo cáo y học: "Association of MICA with rheumatoid arthritis independent of known HLA-DRB1 risk alleles in a family-based and a case control study" pps

Báo cáo y học: "Association of MICA with rheumatoid arthritis independent of known HLA-DRB1 risk alleles in a family-based and a case control study" pps

Ngày tải lên : 09/08/2014, 14:20
... GGAAGGCTGTGCAGTAATCTAGG, TCCCTTTTCCAGCCTGCC, and bioCTGTGCAGT(L)ATCTAGGCTGAAGG; and MICA-250: AAGGTGATGGGTTCGGGAA, TCTAGCAGAATTGGAGGGAG [21], and bioCTCAGGAC(L)ACGCCGGATT For the MICA250 assay, a genotyping ... MICA-25 0A in our data As there are many links between the innate and adaptive immune systems and involvement of pathogens in the initiation of RA is discussed (reviewed by Falgarone and colleagues ... no association of MICA-250, a two-marker haplotype consisting of MICA-25 0A and a certain HLA-DRB1 allele should have the same transmission rate as a two-marker haplotype consisting of MICA-250G...
  • 11
  • 460
  • 0
Prevalence of severe mental distress and its correlates in a population-based study in rural south-west Uganda doc

Prevalence of severe mental distress and its correlates in a population-based study in rural south-west Uganda doc

Ngày tải lên : 11/08/2014, 15:22
... smoking for males and females Missing data on age at first sex for male and females Missing data on partners in past year for males and females Missing data on consulting a traditional healer ... (67.5%) Missing marital status for male and female Missing data on education for males and females Missing SES index for 45 males and 69 females Missing data on current smoking for males, and on ever ... literacy are low and the main income-earning activities are growing bananas, coffee and beans, and trading fish [18] HIV seroprevalence reported in this study is a representation of the national...
  • 9
  • 248
  • 0