beyond psychoanalysis toward a neurodynamic theory of mental states
Báo cáo khoa học " The nutrients of exotic mushrooms (Lentinula edodes and Pleurotus species) and an estimated approach to the volatile compounds " potx
Ngày tải lên :
28/06/2014, 11:20
... Gida Kalite _ ¨ Kontrolu, Bornova-Izmir: E U Basimevi (pp 14–62) AOAC (1995) Official methods of the Association of Official Analytical Chemists (16th ed.) Arlington, VA: Association of Official Analytical ... Society of Japan, 25(6), 534–542 Kurasawa, S I., Sugahara, T., & Hayashi, J (1982) Proximate and dietary fiber analysis of mushrooms Nippon Shokunhin Koyo Gakkasishi, 29(7), 400–406 Latiff, L A. , Daran, ... Bullerman, 1998) Approximate compositions of mushrooms were found by Kurasawa, Sugahara, and Hayashi (1982); moisture content of P ostreatus was 88.6% ash of L edodes was 7% dw Manzi, Gambelli, Marconi,...
- 7
- 375
- 0
Tài liệu Báo cáo khoa học: Implication of the glutamine synthetase ⁄glutamate synthase pathway in conditioning the amino acid metabolism in bundle sheath and mesophyll cells of maize leaves doc
Ngày tải lên :
18/02/2014, 18:20
... 5Â-CTCATATGCCATGATCTCATCG-3Â, L-FNR (AB035644): forward primer, 5Â-ACAACACAAAATGTCAGCTGC AAAA-3Â; reverse primer, 5Â-AAGGCCAAGAAGGAGTC CAAGAAG-3Â; L-FNR (AB035645): forward primer, 5Â-TTGCTTGAGCTGAACAATACAATGAA-3Â; reverse ... primer, 5Â-GCAACGGCCAAG AATCATGTA-3Â; GDH1 (D49475): forward primer, 5ÂTTGTTCCTTGGGAGGATAGAAAAA-3Â; reverse primer, 5Â-TTGCTTGCAGACAGCATCTCA-3Â; ASN (X82849): forward primer, 5Â-AAAGCTTCATCGCAGCTCGT-3Â; ... 5Â-CACGACACACACACACACGT-3Â; Fd I (M73830): forward primer, 5Â-CTACAACGTGAAGCT GATCAC-3Â; reverse primer, 5Â-GATGGGCATGAATGAT TATGCGC-3Â; Fd II (AB016810): forward primer, 5Â-CCTG GCGGTGTATAGCTAAGCAG-3Â;...
- 14
- 566
- 0
Ecology and Management of Commercially Harvested Chanterelle Mushrooms pdf
Ngày tải lên :
08/03/2014, 14:20
... (Cantharellus cibarius sensu latoa) Name Language Agerola from Girolle Catalonian Amarillo Anzutake Baina Bolet cabriter Cabrilla Camagroc Canarinhos Cantarela Cantarelos Capo gallo Carn de gallina ... Mexico German Spanish, local Italian Italian, localSouth Tyrol, Austria Romanian Italian French Italian German German German Catalonian Catalonian Spanish, localLa Rioja and Navarra, Spain French ... in southeastern and eastern Asia, Japan, Africa, Australia, and Central and South America Chanterelles are especially appreciated in Europe and North America The large number of common names listed...
- 90
- 614
- 0
MUSHROOMS Cultivation, Nutritional Value, Medicinal Effect, and Environmental Impact SECOND EDITION ppt
Ngày tải lên :
15/03/2014, 04:20
... materials that are abundantly available in rural and urban areas can have a positive long-term global impact on human nutrition, health, environmental conservation and regeneration, as well as promoting ... regulated by environmental factors TABLE 1.3 Temperature Range and Optima Species Mycelial Growtha Agaricus bisporus Agaricus bitorquis Auricularia auricula Auricularia polytricha Flammulina velutipes ... mushroom species that can be grown in any populated area of the world on waste materials that are available in abundance in both urban and rural areas indicates the great potential for mushrooms...
- 477
- 1.3K
- 4
Báo cáo Y học: Cloning and expression of two novel aldo-keto reductases from Digitalis purpurea leaves potx
Ngày tải lên :
18/03/2014, 01:20
... (this study); AAC23647, AAD32792, CAB88350 and AAC2346, Arabidopsis thaliana; Medicago, M sativa [16] The amino-acid residues identical to the DpAR1 sequence are indicated by dots Gaps are introduced ... clones of 1324 and 1319 bp, designated DpAR1 and DpAR2, respectively The nucleotide sequences of DpAR1 and DpAR2 have been submitted to the EMBL database and are available under accession numbers AJ309822 ... h a day) Leaves were harvested after and days Plants subjected to salt stress were watered with a solution of 250 mM NaCl and samples collected after and 48 h Leaves were also sampled from heat-shocked...
- 9
- 570
- 0
Báo cáo khoa học: Assimilation of excess ammonium into amino acids and nitrogen translocation in Arabidopsis thaliana – roles of glutamate synthases and carbamoylphosphate synthetase in leaves ppt
Ngày tải lên :
30/03/2014, 01:20
... GAGGCTTCAGGGTGGTACTGG F: AGGAAGACCACATGCTGCTGA R: TCAAAGAAGTCCTGAAGAGCGG F: CCTCTCAGACTCCACTGACAAA R: TTCACTGTCTTCACCAGGAGC F: TCTCAGACAACAGTGAAAAGATCA R: TGTCTTGACCAGGAGCTTGAC F: GCCACCGGGAAAATCATC R: TTCACTGTCTTCTCCAGCAGC ... 5Â-TGTGTTCCATACAACCAAGTGC-3Â; carA forward, 5Â-CACACCAATCTTTACGAGT-3Â; carA reverse, 5Â-CGACAGAAACCCTAAATCCACCGC-3Â; carB forward, 5Â-TGTCCAGTTGCACCATTATCAAA-3Â; and carB reverse, 5Â-CCGGATTGGATTTGGAAGAAGCG-3Â ... F: ATCATTCAAGAGCAGGTTGT R: GACAGTTGAAAGCAGTTATT F: TACACATTTGATCGTGGTTT R: AATCGAAAACCCTTTCTTAA F: TTGGACCTGAGCCAACACTTG R: CATCATCCGTTTTGGTGAGGA F: TGGTCAGGTGGAGATCAGTGC R: GAGGCTTCAGGGTGGTACTGG...
- 16
- 384
- 0
mr bloomfields orchard the mysterious world of mushrooms molds and mycologists oct 2002
Ngày tải lên :
11/06/2014, 00:23
... Aires Cape Town Chennai Dar es Salaam Delhi Hong Kong Istanbul Karachi Kolkata Kuala Lumpur Madrid Melbourne Mexico City Mumbai Nairobi São Paulo Shanghai Singapore Taipei Tokyo Toronto and an ... conventional umbrella-shaped mushrooms, and as such are regarded as a ragbag of species rather than a natural grouping of organisms The natural group is an important concept in biology Contrary to ... dietary habits of the sexual stage of the pathogen In an act of tremendous dedication to science, a German researcher prepared an aromatic culture medium called pigeon manure filtrate agar Compatible...
- 221
- 294
- 0
Báo cáo hóa học: " Facile template-free synthesis of pine needle-like Pd micro/nano-leaves and their associated electro-catalytic activities toward oxidation of formic acid" pot
Ngày tải lên :
21/06/2014, 03:20
... Fukuoka A, Araki H, Sakamoto Y, Inagaki S, Fukushima Y, Ichikawa M: Palladium nanowires and nanoparticles in mesoporous silica templates Inorg Chim Acta 2003, 350:371 14 Ksar F, Surendran G, Ramos ... electro-oxidation Experimental Materials and apparatus PdCl (Shanghai Sinopharm Chemicals Reagent Co., Ltd., China) was used as received Formic acid, H3PO4, and H2SO4 were of analytical-grade purity Doubly ... peak in the process of CVs It is proved that Pd micro/nanoleaves have large active surface area and good electrocatalytic performance of as-prepared catalysts for the formic acid electro-oxidation...
- 6
- 546
- 0
Báo cáo khoa học " An examination of antibacterial and antifungal properties of constituents of Shiitake (Lentinula edodes) and Oyster (Pleurotus ostreatus) mushrooms " doc
Ngày tải lên :
28/06/2014, 11:20
... hand bacteria Wildtype hand bacteria Wildtype hand bacteria Yeasts and filamentous fungi Aspergillus flavus QC 6658 Aspergillus fumigatus 27.5 Aspergillus niger 27.5 Candida albicans Candida glabrata ... 2007;16:94–9 13 Maeda Y, Loughrey A, Earle JA, Millar BC, Rao JR, Kearns A, et al Antibacterial activity of honey against community associated methicillin-resistant Staphylococcus aureus (CA-MRSA) Complement ... MCM, Vanetti MCD Antibacterial activity of Lentinula edodes Braz J Microbiol 2001;32:206–10 10 Sugiyama K, Arashi T, Yamakawa A Eritadenine-induced alteration of hepatic phospholipid metabolism...
- 3
- 347
- 0
Báo cáo khoa học " Chitin content of cultivated mushrooms Agaricus bisporus, Pleurotus ostreatus and Lentinula edodes Janos Vetter " doc
Ngày tải lên :
28/06/2014, 11:20
... number of analysed samples and of species or of varieties, and the absence of data on chitin contents of two morphological parts of fruit body (pileus and stipe) The aims of these investigations ... given as the arithmetical means (in percent of DM) with standard deviations (±SD) The statistical evaluation of the analytical data were performed by using the software ‘Origin 4.0’ Results and ... ostreatus The biological role of the TDF (glucan and of chitin) of mushrooms was recently evaluated Five percent of chitin in the diet of Wistar rats (Zacour, Silva, Cecon, Bambirra, & Vieira,...
- 4
- 325
- 0
Báo cáo tin học: "Spanning Trees with Many Leaves and Average Distance" ppt
Ngày tải lên :
07/08/2014, 15:23
... notion of a trunk, we call a hoop for a graph G a cycle subgraph (not necessarily induced) that contains a dominating set of G We know by Lemma an upper bound on the average distance of graphs ... tree T0 of the first bipartite component B0 has at least µ leaves, of which µ are in a common color class of B0 ; let R0 be a set of µ monochromatic leaves of 2 B0 Since B0 is a maximal bipartite ... distance in graphs: Among all graphs of order n, the path on n vertices has the maximum total distance (and thus maximum average distance) [18] Lemma Let G be a graph with a trunk of order t ≥...
- 16
- 220
- 0
Báo cáo lâm nghiệp: "Seasonal and intraspecific variation of frost tolerance in leaves of three Canarian laurel forest tree species" doc
Ngày tải lên :
08/08/2014, 00:22
... standard deviations Table I Average values and standard deviations of the Fv/Fm parameter in response to freezing temperatures in sun and shade leaves of Laurus azorica during warm and cold seasons ... seasons Table II Average values and standard deviations of the Fv/Fm parameter in response to freezing temperatures in sun and shade leaves of Persea indica during warm and cold seasons L azorica Temperature ... canario, Edirca, Las Palmas de Gran Canaria, 1986 [11] González-Rodríguez A. M., Caracterización fotosintética de árboles de la laurisilva canaria, Universidad de La Laguna, Tenerife, Spain, 1998 [12]...
- 6
- 261
- 0
Báo cáo khoa học: "An efficient micro-method of DNA isolation from mature leaves of four hardwood tree species Acer, Fraxinus, Prunus and Quercus" pdf
Ngày tải lên :
08/08/2014, 14:21
... dry leaves and buds of several Fraxinus species (Dr N Frascaria, ENGREF, Paris, France; pers comm.), seeds of Acacia mangium and Acacia crassicarpa, young and expanded leaves and chloroplast enriched ... denaturant sequencing gel (CastAway gel % polyacrylamide) run in a CastAway Sequencing System (Statagene, La Jolla, USA) Gels were run for h at 500 V, and then silver stained according to a modified ... 0.25, 0.5 and μg) of uncut λ DNA (Promega, USA) DNA quality was also estimated on the same gels at 2.4 DNA digestion DNA was digested by Hind III restriction enzyme (Stratagene, Cambridge,...
- 5
- 389
- 0
Báo cáo khoa học: "Consequences of an excess Al and a deficiency in Ca and Mg for stomatal functioning and net carbon assimilation of beech leaves" ppt
Ngày tải lên :
08/08/2014, 14:22
... excess Al and a deficiency in Ca and Mg was calculated for +Al–CaMg plants (–70%) The decrease in A was accompanied by a constancy of the calculated sub-stomatal CO2 mole fraction (ci) On a chlorophyll ... concentrations was recorded in the leaves of +Al, –CaMg and +Al–CaMg plants to about 40% of the control values The ratio chl a/ chl b was never affected Mean net CO2 assimilation rates (A) , on a leaf ... remained constant and similar to the value recorded in control dark-adapted leaves, i.e 0.9 3.3 Stomatal response to ABA Stomatal responses to an application of exogenous ABA via the transpiration...
- 10
- 376
- 0
Báo cáo khoa học: "The effect of light acclimation of single leaves on whole tree growth and competition – an application of the tree growth model ALMIS" doc
Ngày tải lên :
08/08/2014, 14:22
... + (PAssim * c * ∆Time) AG = dep of assimilation on stomatal conductance; AI = light dep assimilation rate; AK = capacity of net photosynthesis; Amax = maximum assimilation rate; AT = temperature ... are arranged in a hierarchical system The different objects are all in constant communication via the transfer of information and materials [1] ALMIS includes an “environment part” and a “plant ... attenuation of irradiance within the tree canopy is a function of leaf area: irradiance in each cube is calculated according to the summed total leaf surface in the cubes above The parameterization...
- 11
- 358
- 0
Báo cáo lâm nghiệp: "Limitation of photosynthetic activity by CO 2 availability in the chloroplasts of oak leaves from different species and during drought" pdf
Ngày tải lên :
08/08/2014, 18:21
... with an IBM Personal Computer AT3, connected to a data-logger (SAM80, AOIP, France), with a software devel- ducers in the laboratory allowing on line calculation of gas exchange, and digital control ... Limitations of net CO assimilation rates by internal resistances to CO transfer in leaves of two species (Fagus syl2 vatica L and Castanea sativa Mill) Plant Cell Environ 18, 43-51 Evans JR, Sharkey ... mol CO and by -1 , measuring A and Φ at increasing irradiances II eΦ was then calculated as in equation [2], assuming that nonphotorespiratory respiration remained constant and equal to...
- 12
- 346
- 0
Báo cáo lâm nghiệp: "Starch and soluble carbohydrates in leaves of water-stressed oak saplings" ppsx
Ngày tải lên :
08/08/2014, 18:21
... on many European oaks Table I Predawn leaf water potential (Ψ and ) wp net CO assimilation rates (A) in control and water-stressed leaves of Quercus petraea saplings (mean of four replicates ... drought on the rate of CO assimilation and the amount of soluble and insoluble carbohydrates in leaves of 4-year-old saplings of Q petraea The aim of these experiments was to assess whether the ... Osmotic adjustment in response to soil drought has been reported for many North American oak species plants (Jones et al, 1980) Large (Abrams, 1990) including Q alba, Q macrocarpa and Q stellata (Parker...
- 6
- 246
- 0
Báo cáo khoa học: "Distribution and variations of potassium and calcium in different cross sections of Picea abies Karst needles and Fagus sylvatica (L) leaves exposed to ozone and mild water stress" docx
Ngày tải lên :
08/08/2014, 19:21
... analysed All measurements were made using an X-ray take-off angle of 45°, a measuring time of 100 s, a magnification of 000 for all examined tissues (stomata, epidermis, mesophyll, parenchyma ... Statistical analyses The statistical treatment employed was the analysis of variance (a 0.05) by the GLM procedure (SAS Institute Inc, 1985) Test of equality of averages using Student-Newman and ... however, as potted plants were used and McConnaughay et al (1993) have shown that nutrient changes in such trees can be artifacts of the experimental conditions Experimental site and plant material...
- 12
- 299
- 0