beyond monism and dualism constitutionalism as a principled framework for legal pluralism

Assessment of pretreatments and enzymatic hydrolysis of wheat straw as a sugar source for bioprocess industry

Assessment of pretreatments and enzymatic hydrolysis of wheat straw as a sugar source for bioprocess industry

Ngày tải lên : 05/09/2013, 15:28
... And such a whole suite of accessory enzymes is required for efficient xylan hydrolysis such as α-arabinofuranosidases and α-Larabinases that release arabinan [31], α-glucuronidases that release ... fatty acids and fatty alcohols, sterols and alkanes Natural waxes have a wide range of industrial uses in cosmetics, polishes and coatings, pharmaceuticals, and insecticides Wheat straw contains ... endo-glucanase, exo-glucanase and β-glucosidase Endo -and exo-glucanases are commonly referred to as “cellulases” Fungal strains of Trichoderma reesei are used to produce most commercial cellulase...
  • 20
  • 437
  • 0
Báo cáo khoa học: Apoptosis and autophagy: BIM as a mediator of tumour cell death in response to oncogene-targeted therapeutics pptx

Báo cáo khoa học: Apoptosis and autophagy: BIM as a mediator of tumour cell death in response to oncogene-targeted therapeutics pptx

Ngày tải lên : 16/03/2014, 00:20
... pathway and the Janus kinase ⁄ signal transducer and activator of transcription (JAK-STAT) pathway, to promote proliferation, survival and transformation [56,57] The importance of the BCR–ABL ... with advanced non-small-cell lung, breast, colon, and pancreatic cancer J Clin Oncol 22, 4456–4462 Solit DB, Garraway LA, Pratilas CA, Sawai A, Getz G, Basso A, Ye Q, Lobo JM, She Y, Osman I et al ... a potent inhibitor of mitogen-activated protein kinase ⁄ extracellular signal-regulated kinase kinase ⁄ kinases: mechanism of action in vivo, pharmacokinetic ⁄ pharmacodynamic relationship, and...
  • 13
  • 453
  • 0
Báo cáo khoa học: Structure, epitope mapping, and docking simulation of a gibberellin mimic peptide as a peptidyl mimotope for a hydrophobic ligand pot

Báo cáo khoa học: Structure, epitope mapping, and docking simulation of a gibberellin mimic peptide as a peptidyl mimotope for a hydrophobic ligand pot

Ngày tải lên : 16/03/2014, 23:20
... restraints, and eight dihedral angle restraints Fifty conformations that give low conformation energy and that give no distance and dihedral angle violations greater than ˚ ˚ 0.5 A and A, respectively, ... function was applied to the t1 and t2 dimensions Peak picking and assignment were performed with sparky (T D Goddard and D G Kneller, sparky 3, University of California, San Francisco, CA) 1D and 2D ... peptide-antibody recognition 11 Murata T, Fushinobu S, Nakajima M, Asami O, Sassa T, Wakagi T & Yamaguchi I (2002) Crystal structure of the liganded anti-gibberellin A4 antibody 4-B8(8) ⁄ E9 Fab fragment...
  • 11
  • 565
  • 0
Báo cáo khoa học: Combining theoretical analysis and experimental data generation reveals IRF9 as a crucial factor for accelerating interferon a-induced early antiviral signalling pdf

Báo cáo khoa học: Combining theoretical analysis and experimental data generation reveals IRF9 as a crucial factor for accelerating interferon a-induced early antiviral signalling pdf

Ngày tải lên : 23/03/2014, 03:20
... concentrations result in earlier maximal pathway activation and an increase in signal amplitude [3,4] Furthermore, alterations in the activity of a kinase or phosphatase may affect the speed of signalling ... incubated with anti-IRF9 IgGs (Santa Cruz, CA, USA, antibody 10793) as primary antibody and anti-rabbit Alexa Fluor 680 (Invitrogen) as secondary antibody, and analysed by flow cytometry using a FACSCalibur ... using an RNeasy Plus Mini Kit (Qiagen, Hilden, Germany) The RNA was used for the quantitative real-time PCR and microarray analysis To generate cDNA, lg of total RNA was transcribed using a QuantiTect...
  • 14
  • 432
  • 0
Test  of English  as a  Foreign Language for Internet-Based Testing: Information and Registration BULLETIN

Test of English as a Foreign Language for Internet-Based Testing: Information and Registration BULLETIN

Ngày tải lên : 25/03/2014, 10:41
... BWA BRA BRN BGR BFA BDI KHM CMR CAN CPV CYM CAF TCD CHL CHN Afghanistan Albania Algeria American Samoa Andorra Angola Anguilla Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan ... NATIVE LANGUAGE CODES AFR AKA ALB AMA ARA ARM ASM AZE BAM BAK BAQ BEL BEM BEN BER BIK BOS BUL BUR CAT CEB NYA CHI CHV Afrikaans Akan Albanian Amharic Arabic Armenian Assamese Azerbaijani Bambara ... ORM PAU POL PON POR Latvian Lingala Lithuanian Luba-Lulua Luo Macedonian Madurese Malagasy Malay Malayalam Maltese Marathi Marshallese Mende Minangkabau Mongolian Mossi Nepali Norwegian Oriya Oromo...
  • 28
  • 764
  • 2
Báo cáo khoa học: A novel plant protein disulfide isomerase family homologous to animal P5 – molecular cloning and characterization as a functional protein for folding of soybean seed-storage proteins docx

Báo cáo khoa học: A novel plant protein disulfide isomerase family homologous to animal P5 – molecular cloning and characterization as a functional protein for folding of soybean seed-storage proteins docx

Ngày tải lên : 30/03/2014, 04:20
... TGTAAAG TGTAAAG + ) + )95 )1100 )1470 ACACacG ACACttG ACACaaG + + + + ) ) ) ) ) )140 )1100 )1596 )1632 )140 )1100 )1596 )1632 )1874 CAaaTG CAagTG CAaaTG CAaaTG CAaaTG CActTG CAttTG CAgtTG TGAGTCA ... peptide was constructed as follows The DNA fragment was amplified from GmPDIM cDNA by PCR using the primers 5¢-GACGACGACAAGATGC ACGCACTCTATGGAGC-3¢ and 5¢-GAGGAGAAGC CCGGTTCATAGCTCATCCTTGCTTGAAG-3¢ ... soybean cotyledons during maturation (A) GmPDIM mRNA was quantified by real time RT-PCR Each value was standardized by dividing the value by that for actin mRNA Values are calculated as a percentage...
  • 12
  • 348
  • 0
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

Ngày tải lên : 18/06/2014, 16:20
... type diabetes subjects Immunogenetics 2010, 62:101-107 36 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association ... Pediatr Res 2000, 48:6-11 19 Bernasconi A, Marino R, Ribas A, Rossi J, Ciaccio M, Oleastro M, Ornani A, Paz R, Rivarola MA, Zelazko M, Belgorosky A: Characterization of immunodeficiency in a patient ... Health Center, 1650 Cedar Avenue, Montreal, H3G 1A4 , Qc, Canada Full list of author information is available at the end of the article thymic and peripheral CD4+ T cells in humans and mice, and...
  • 12
  • 573
  • 0
Báo cáo sinh học: "Including Emergency and Acute Care as a Global Health Priority" doc

Báo cáo sinh học: "Including Emergency and Acute Care as a Global Health Priority" doc

Ngày tải lên : 18/06/2014, 18:20
... coordination of the research effort, and the drafting and editing of the manuscript All authors read and approved the final manuscript Authors’ information The International Acute Care Research ... Emergency and Acute Care as a Global Health Priority Authors: Nicholas Risko, MHS University of Maryland School of Medicine 655 W Baltimore Street, Baltimore MD 21201, USA nicholas.risko@som.umaryland.edu ... guidance and participated in the drafting and editing of the manuscript MN provided guidance and participated in the drafting and editing of the manuscript JMH participated in the design and...
  • 5
  • 274
  • 0
Báo cáo hóa học: " Including Emergency and Acute Care as a Global Health Priority" potx

Báo cáo hóa học: " Including Emergency and Acute Care as a Global Health Priority" potx

Ngày tải lên : 20/06/2014, 01:20
... coordination of the research effort, and the drafting and editing of the manuscript All authors read and approved the final manuscript Authors’ information The International Acute Care Research ... Emergency and Acute Care as a Global Health Priority Authors: Nicholas Risko, MHS University of Maryland School of Medicine 655 W Baltimore Street, Baltimore MD 21201, USA nicholas.risko@som.umaryland.edu ... guidance and participated in the drafting and editing of the manuscript MN provided guidance and participated in the drafting and editing of the manuscript JMH participated in the design and...
  • 5
  • 327
  • 0
Báo cáo toán học: " Including emergency and acute care as a global health priority" potx

Báo cáo toán học: " Including emergency and acute care as a global health priority" potx

Ngày tải lên : 20/06/2014, 21:20
... effort, and the drafting and editing of the manuscript All authors read and approved the final manuscript Authors’ information The International Acute Care Research Collaborative (IACRC), located ... performed background research and had a primary role in drafting the manuscript EJBC conceived of the manuscript and participated in its drafting and editing SR provided guidance and participated ... point for both immediate injury care and for populations whose health is not adequately protected and monitored by a primary care safety net [8] By developing core messages backed by research and...
  • 2
  • 198
  • 0
Báo cáo hóa học: "ZnSe nanotrenches: formation mechanism and its role as a 1D template" potx

Báo cáo hóa học: "ZnSe nanotrenches: formation mechanism and its role as a 1D template" potx

Ngày tải lên : 21/06/2014, 04:20
... material is pure Au with epitaxial relationship of [100]Au//[100]ZnSe in contrast to the AuZnδ alloy phase and the lattice misalignment of the catalytic droplets It is believed that the nanodashes ... that a spherical shape for a non-contacted nanodroplet has the smallest surface area so as to minimize its surface energy In our previously published article, we have discussed the reason for ... -oriented self-assembled formation of nanogroove structure at the surface of an annealed Fe/ZnSe bilayer [18], we have also pointed out that a bare ZnSe surface annealed at high temperature can itself...
  • 6
  • 419
  • 0
Báo cáo toán học: "a matrix representation of graphs and its spectrum as a graph invariant" ppt

Báo cáo toán học: "a matrix representation of graphs and its spectrum as a graph invariant" ppt

Ngày tải lên : 07/08/2014, 13:21
... m(= l) Case A: j = l Case B: j = l i = l(= m) Case C: j = m Case D: j = m i = m and i = l Case E: j = m(= l) Case F: j = l(= m) Case G: j = m and j = l For each case we count the possible paths ... Graph equivalence and characterization via a continuous evolution of a physical analog, cond-mat/0209112 [7] F Harary, Frank and R Z Norman, Some properties of line digraphs, Rend Circ Mat Palermo ... tion matrix P such that M(G) = P M(H)P −1, where M(G) and M(H) are the adjacency matrices of the graphs G and H, respectively Harary and Norman [7] proved that if → − → − D and F are digraphs...
  • 14
  • 403
  • 0
Báo cáo khoa học: "Combination therapy with docetaxel and S-1 as a first-line treatment in patients with advanced or recurrent gastric cancer: a retrospective analysis" docx

Báo cáo khoa học: "Combination therapy with docetaxel and S-1 as a first-line treatment in patients with advanced or recurrent gastric cancer: a retrospective analysis" docx

Ngày tải lên : 09/08/2014, 03:21
... Takagane A, Akiya T, Takagi M, Miyashita K, Nishizaki T, Kobayashi O, Takiyama W, Toh Y, Nagaie T, Takagi S, Yamamura Y, Yanaoka K, Orita H, Takeuchi M: S-1 plus cisplatin versus S-1 alone for first-line ... with advanced gastric cancer Cancer Chemother Pharmacol 2009, 64:877-883 Yoshida K, Hirabayashi N, Takiyama W, Ninomiya M, Takakura N, Sakamoto J, Nishiyama M, Toge T: Phase I study of combination ... therapy with S-1 and docetaxel (TXT) for advanced or recurrent gastric cancer Anticancer Res 2004, 24:1843-1851 Yoshida K, Ninomiya M, Takakura N, Hirabayashi N, Takiyama W, Sato Y, Todo S, Terashima...
  • 7
  • 407
  • 0
Báo cáo y học: "Metalloproteinase and inhibitor expression profiling of resorbing cartilage reveals pro-collagenase activation as a critical step for collagenolysis" pot

Báo cáo y học: "Metalloproteinase and inhibitor expression profiling of resorbing cartilage reveals pro-collagenase activation as a critical step for collagenolysis" pot

Ngày tải lên : 09/08/2014, 08:22
... TAGGTGCATATAAACAAGAAGTA ADAMTS-1 GCTGCCCTCACACTGCGGAAC 264 CATCATGGGGCATGTTAAACAC ADAMTS-4 GCGCCCGCTTCATCACTG 101 TTGCCGGGGAAGGTCACG ADAMTS-5 AAGCTGCCGGCCGTGGAAGGAA 196 TGGGTTATTGCAGTGGCGGTAGG ADAMTS-8 ... Hydroxyproline release was assayed as a measure of collagen degradation, and glycosaminoglycan release was assayed as a measure of proteoglycan degradation [20] Collagenase and inhibitor activities in ... GATGTACCGAGGATTCACCAAGAT 356 GCCGGATGCAAGCGTAGT TIMP-4 ATATTTATACGCCTTTTGATTCCT 297 GGTACCCGTAGAGCTTCCGTTCC α2 M GCCCGCTTTGCCCCTAACA 359 TCGTCCACCCCACCCTTGATG RECK GTAATTGCCAAAAAGTGAAA 352 TAGGTGCATATAAACAAGAAGTA...
  • 12
  • 526
  • 0
Báo cáo y học: " Serum levels of hyaluronic acid and chondroitin sulfate as a non-invasive method to evaluate healing after cartilage repair procedures" pptx

Báo cáo y học: " Serum levels of hyaluronic acid and chondroitin sulfate as a non-invasive method to evaluate healing after cartilage repair procedures" pptx

Ngày tải lên : 09/08/2014, 14:21
... cell-based therapy, such as ACI [5], over marrowstimulation techniques, such as SD or microfracture Second, the authors describe two potential candidate factors to follow tissue maturation and healing: ... aimed at repairing articular cartilage, assist surgeons to select the appropriate procedure for any given patient, and post-operatively, allow an individualized determination of when it is safe ... demonstrated better visual and histological appearance than those treated with drilling Three of the five AC biopsies were near normal, and the other two showed at least 50% fill and peripheral integration...
  • 2
  • 358
  • 0
Báo cáo y học: "Small RNA sequencing reveals miR-642a-3p as a novel adipocyte-specific microRNA and miR-30 as a key regulator of human adipogenesis" ppt

Báo cáo y học: "Small RNA sequencing reveals miR-642a-3p as a novel adipocyte-specific microRNA and miR-30 as a key regulator of human adipogenesis" ppt

Ngày tải lên : 09/08/2014, 23:20
... genome (release hg19) accounted for miRNAs annotated in mirBase (release 16) Other small RNA species, such as piwi-interacting RNAs (piRNAs) and small nucleolar RNAs (snoRNAs), were also identified ... renilla and firefly luciferase activities were assayed with the Dual Glo Luciferase Assay System (Promega) and measured with a luminometer (Luminoskan Ascent, Thermo Scientific, Waltham, MA, USA) ... extracted and analyzed at day of differentiation Mature miRNA expression was evaluated using Mirscript assays (Qiagen SA) as specified by the manufacturer’s protocol Real-time PCR was performed...
  • 13
  • 365
  • 0
báo cáo khoa học: " Using Mitrofanoff’s principle and Monti’s technique as a surgical option for bladder augmentation with a continent stoma: a case report" pps

báo cáo khoa học: " Using Mitrofanoff’s principle and Monti’s technique as a surgical option for bladder augmentation with a continent stoma: a case report" pps

Ngày tải lên : 11/08/2014, 00:22
... ileocystoplasty and, for patients unable or not adapted to intermittent catheterization, Mitrofanoff’s principle (in which the vascularized ileocecal appendix is anastomosed at the skin and bladder, ... of a continent catheterizable stoma using the appendix has been a mainstay in the armamentarium of pediatric urologists Figure Association of Mitrofanoff’s principle and Monti’s technique Anastomosis ... skin and the appendix that is Page of anastomosed at the bladder wall with a nonrefluxing anastomosis Conclusion The association of Mitrofanoff’s principle with the Monti procedure is feasible and...
  • 3
  • 247
  • 0
báo cáo khoa học: " Implementing and evaluating a regional strategy to improve testing rates in VA patients at risk for HIV, utilizing the QUERI process as a guiding framework: QUERI Series" pptx

báo cáo khoa học: " Implementing and evaluating a regional strategy to improve testing rates in VA patients at risk for HIV, utilizing the QUERI process as a guiding framework: QUERI Series" pptx

Ngày tải lên : 11/08/2014, 05:22
... assistants, and post-graduate medical trainees) from the primary care administration staff at Facilities A and B The data on provider types were used to compare HIV testing and evaluation performance across ... and sub-station levels – and for clustering We have obtained information regarding all inpatient and outpatient patient encounters within VISN 22 from a preestablished network database For patients ... changes, has been shown to improve performance of vaccination, cardiovascular risk reduction, and breast and colorectal cancer screenings [9,10,28,31-33] Electronic clinical reminders are a standard...
  • 13
  • 341
  • 0
Báo cáo khoa hoc:" Evaluation of triblock copolymeric micelles of δvalerolactone and poly (ethylene glycol) as a competent vector for doxorubicin delivery against cancer" doc

Báo cáo khoa hoc:" Evaluation of triblock copolymeric micelles of δvalerolactone and poly (ethylene glycol) as a competent vector for doxorubicin delivery against cancer" doc

Ngày tải lên : 11/08/2014, 08:20
... the amount of formazan crystals formed was measured after h of MTT addition (10% v/v) by adding isopropyl alcohol and OD measurement at 570 nm The relative cell viability in percentage was calculated ... Matsumura Y, Suzuki M, Shimizu K, Goda R, Nakamura I, Nakatomi I, Yokoyama M, Kataoka K, Kakizoe T: NK105, a paclitaxelincorporating micellar nanoparticle formulation, can extend in vivo antitumour activity ... doxorubicin European Journal of Cancer 2000, 36:1149-1160 39 Upadhyay KK, Bhatt AN, Mishra AK, Dwarakanath BS, Jain S, Schatz C, Le Meins JF, Farooque A, Chandraiah G, Jain AK: The intracellular drug delivery...
  • 14
  • 252
  • 0
báo cáo khoa học: " Implementing and evaluating a regional strategy to improve testing rates in VA patients at risk for HIV, utilizing the QUERI process as a guiding framework: QUERI Series" docx

báo cáo khoa học: " Implementing and evaluating a regional strategy to improve testing rates in VA patients at risk for HIV, utilizing the QUERI process as a guiding framework: QUERI Series" docx

Ngày tải lên : 11/08/2014, 16:21
... assistants, and post-graduate medical trainees) from the primary care administration staff at Facilities A and B The data on provider types were used to compare HIV testing and evaluation performance across ... and sub-station levels – and for clustering We have obtained information regarding all inpatient and outpatient patient encounters within VISN 22 from a preestablished network database For patients ... changes, has been shown to improve performance of vaccination, cardiovascular risk reduction, and breast and colorectal cancer screenings [9,10,28,31-33] Electronic clinical reminders are a standard...
  • 13
  • 588
  • 0