... sites and an erythematous right groin, with bilateral groin sinuses andsome lymphadenopathy on palpation Cardiovascular, respiratory and abdominal examination was unremarkable Analysis of blood ... vena cava andtothe lungs We advocate the need for a high degree of clinical suspicion, an early diagnosis, and prompt institution of effective antimicrobial therapy to decrease the mortality and ... clinical and AK for laboratory work, all contributed tothe writing ofthe article All authors have seen and approved the final manuscript Acknowledgements Conclusion Our case emphasizes the local...
... samples The fragment that was sequenced from mother D1 was shown to carry a 98-bp deletion that changes the reading frame ofthe gene and predicts a premature translational stop after 632 amino acids ... reaction toa ®nal concentration of M (Sigma, St Louis, MO, USA) A pair of primers, referred to as BSSL 12and BSSL 14, was designed to cover the entire sequence of repeats (BSSL 12: 5¢-ACCAACTTCCT ... i.e after 610 amino acids In both cases the deletion changes the reading frame and predicts a new C-terminal tail (RAAHG) Besides the deletions, the sequences of D1 and D2 were identical to the...
... and abstracts AF and MP (1st reviewers) and EGS and JGA (2nd reviewers) assessed full texts ofthe identified studies and extracted the relevant data EGS, MP and JGA drafted the manuscript All authors ... 48:20-8 Letrait M, Lurie A, Bean K, Mesbah M, Venot A, Strauch G, Grandordy BM, Chwalow J: The Asthma Impact Record (AIR) index: a rating scale to evaluate the quality of life of asthmatic patients ... Additional file 1: Search strategy: MEDLINE, EMBASE, CINAHL and PSYCHINFO Outline ofthe search strategy used for electronic database searching List of Abbreviations APA: American Psychological Association;...
... located at the right supraclavicular fossa was noted, so a computed tomography (CT) contrast scan was performed The results ofthe CT scan showed a small right supraclavicular fossa hematoma, ... [http://www.emedicinehealth.com/ venous_access_devices/page3_em.htm] Randolph AG, Cook DJ, Gonzales CA, Andrew M: Benefit of heparin in central venous and pulmonary artery catheters: a meta-analysis of randomized ... no active bleeding, anda triangular foreign body of metallic tomographic appearance, approximately mm in length, in the interstitial space between right subclavian vein and artery There was...
... deletion of p53 and ATM genes andthe presence ofthe rearrangement of BCL6 gene This means that he is at high risk of developing a cancerous disease and may also develop malignant lymphoma and many ... fissures, granulomas, vascular dilatation, pseudopolyps, mucosal inflammation ofthe small and large bowel, and granulomas in local lymph nodes were observed The tip ofthe appendix was inflamed too ... intestinal surface and ulcers, two of which had parietal ruptures with fluid escape A resection of 45 cm ofthe ileo-jejunal portion, including all areas of intestinal damage, was performed anda primary...
... has also been reported after a traumatic experience such as sexual abuse [6], divorce andthe death ofa loved one [7] Its presence has been associated with impairment ofthe socialisation and ... and time of referral [5] Current management involves behavioural therapy, family therapy and in some cases pharmacotherapy [5] PTSD is a highly prevalent condition among children exposed toa ... highlights the necessity of health professional and parental awareness of post-traumatic psychiatric morbidity in children subsequent toa physical trauma Having knowledge of these disorders may be...
... loin pain, nausea and vomiting, and that of pulmonary embolism have substantially decreased Selective embolization of renal AVMs allows preservation ofthe renal parenchyma and therefore leads to ... KP is the head ofthe Department of Urology and was also responsible for the format and revisions ofthe manuscript IA and MP were the treating anaesthesiologists while TP and AF were the interventional ... computed tomography material, arterial phaseadminisAxial computed tomography scan after intravenous administration of iodinated contrast material, arterial phase A filling defect of soft tissue...
... secretion and sympathetic activity, as seen in postprandial hypotension [16,17] Renin secretion and enhanced sympathetic activity raise ADH and aldosterone secretions These hormones retain water and ... adequate water ingestion This can lead toa new balance that leads to an expanded ECF compartment and increased risk of arterial hypertension The risk can be higher in individuals with impaired ... days An individual that on average takes several HFCS soft drinks each day can make his colon prone to sustained increased sodium absorption, despite adequate sodium ingestion and more than adequate...
... both the 5¢- and 3¢-UTR The major differences were a 26 bp insertion in the 5¢-UTR ofthe cDNA and an insertion of12 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG (31 bp) in the ... is relaced by ‘|’ and insertions indicated by ‘-’ The two insertions in the 5¢- and 3¢-UTR are underlined andthe 13 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG (31 bp) in the 3¢-UTR ... SIGNALP 3.0 [23] andthe potential N-glycosylation site (NQT) are in bold and underlined The four potential poly (A) signals (AATAAA) in the 3¢-UTR andthe TATA box in the 5¢-flanking region are...
... spectrum-regular, a result already used by Van Dam in [10] Generalizing some results of Haemers and Van Dam [12] (for d = 3), and Garriga, Yebra, andthe author [20] (for |Γd (u)| = 1), Garriga andthe author ... alternating and adjacency polynomials, and their relation with the spectra and diameters of graphs, submitted [17] M .A Fiol and E Garriga, From local adjacency polynomials to locally pseudodistance-regular ... is easy to show, examples of walk-regular graphs are the vertex-transitive and/ or distance-regular graphs Let Γ be a τ -partially walk-regular graph with τ < d, and adjacency matrix A Consider...
... stated that primary duodenal adenocarcinoma is oneofthe main causes of death in patients with FAP [11] A case of an early duodenal adenocarcinoma from a Brunner's gland has been reported [12] ... depicting a mass Computed tomography ofthe abdomen depicting a mass (arrows) in the duodenum was carried out Histological examination revealed a lowgrade duodenal adenocarcinoma of maximal diameter ... declare that they have no competing interests Authors' contributions GA, IV and CK carried out the surgical procedure and contributed tothe design ofthe study; GA and AM gathered the data, drafted...
... discussions ofthe study 24 M .A. Thesis CHAPTER 4: Results and Discussions 4.1 Quantitative data Overall Evaluation ofthe Reading Section Before analyzing the results ofthe quantitative and qualitative ... half ofthe total andthe rest belongs tothe Pre and Post reading ones The distribution of tasks is not even Examining the nature ofthe reading tasks helps the researcher to have preliminary ... access to many types of materials such as magazines, newspaper, works of fiction etc In term of reading capacity, they can understand the content ofthe text as a whole and they are capable of going...
... indicate that the potential effects of driving and grouting on the CPTs taken within m of C1s and JP1s axes are not resolvable against the background ofthe sites natural soil variability The availability ... reusing pre-installed aged foundations Equally, it is clear that piles driven in sand are damaged by failure and cannot carry the same loads as intact aged piles There are therefore clear problems ... are $8% higher than the equivalent static capacities Taken together, these additional data indicate static tension capacities of around 3150 kN for the 22 m CLAROM piles at around 20002100 days;...
... variables are parameterized conditional distributions Parameters ofthe functions are parameters ofthe graph Z Ghahramani, “Graphical model: Parameter learning” Earthquake Burglary Alarm Newscast ... Introduction to topic modeling The main way of automatic capturing the meaning of documents Topic: the subject that we talk/write about Topic of an image: a cat, a dog, airplane, … Topic in ... going off during an earthquake He concludes it is more likely that earthquake causes the alarm Earthquake Burglary Alarm Call Newscast Graphical Models An overview Graphical models (probabilistic...
... increases by an amount dh andthe radius ofthe contact area decreases by an amount dr, then the nanowire growth continues, the inclination angle (α) at the base ofthe nanowires increases from the zero ... situation could be modeled for GaAs substrate II.2 The shape ofthe Au droplet The shape ofthe Au droplet is crucial for nanowire growth by VLS method The shape ofa catalyst particle at the ... making the Au contact on GaAs semiconductor [10, 11] , here the Authors have also stated that the low-temperature formation of voids in the gold lattice and crystallite growth on the gold surface,...
... Spinocerebellar degeneration Ataxiatelangiectasia and malignant tumour [Japanese] Naika no Ryôiki (Domain of Internal Medicine) 1975, 35:623-626 Watanabe A, Hanazono H, Sogawa H, Takaya H: Stomach cancer ... adenocarcinoma that was resected Case presentation The patient is a 20 year old female that was diagnosed with ataxia-telangiectasia syndrome at years of age She had severe ataxia and was wheelchair ... markedly dilated stomach, abnormal thickening in the region ofthe antrum and pylorus ofthe stomach, and adjacent pancreas thinned dueto compression from dilated stomach There was no intraabdominal...
... Histopathology evaluation, further study of slides and in depth analysis SRB – Critical revision and final approval ofthe version to be published All authors read and approved the final manuscript ... fulminant hepatic failure: presentation ofa case and review ofthe literature Eur J Gastroenterol Hepatol 2003, 15 :123 5-40 Tanaka M, Watanabe S, Masaki T, Kurokohchi K, Kinekawa F, Inoue H, Uchida ... selection, analysis and drafting the manuscript ANB – Case analysis and initial drafting of manuscript GS – Contributions to conception, arranging histopathology, revision ofthe manuscript SGH – Histopathology...
... roenterogram ofthe pelvis and left hip was obtained and revealed a large area of avascular necrosis withinthe left femoral head with significant lateral cortical lucency Four months later, a mid-morning ... injection of triamcinolone acetonide while they were also receiving the fixed-dose combination of emtricitabine and tenofovir plus ritonavir and atazanavir They had no history of concomitant inhaled, ... http://www.aidsrestherapy.com/content/6/1/10 tration was 693/μL and her viral load was undetectable She had been vaccinated against hepatitis Aand B and was not infected with hepatitis C Upon presentation...
... ureteral catheters are showing (white arrows) while the annulus ofthe mechanical valves (black arrow) andthe wires ofthe epicardial pace maker are also seen All authors: have made substantial ... Valvular heart disease andthe use of dopamine agonists for Parkinson's disease N Engl J Med 2007, 356:39-46 Yamamoto M, Uesugi T, Nakayama T: Dopamine agonists and cardiac valvulopathy in Parkinson's ... is unclear and may be related tothe lower pergolide doses used in Asian patients There are only a few reported cases of patients who had surgery for cardiac disease acquired dueto medications...