baroudi j orikowski w 1988 a short form measure of user information satisfaction a psychometric evaluation and notes on use journal of management information systems 4 4 45 59
báo cáo hóa học: " Construction and validation of a short-form Quality-Of-Life Scale for Chinese Patients with Benign Prostatic Hyperplasia" pptx
... et al: Validation of a new quality of life questionnaire for benign prostatic hyperplasia J Clin Epidemiol 1992, 45 : 143 1– 144 5 Bertaccini A, Martinelli A and Ceccarelli R, et al: Development and ... validation of the BSP-BPH (Bononian Satisfaction Profile – Benign Prostatic Hyperplasia) a "disease-specific" questionnaire for the evaluation of health related quality of life in patients with ... of this article All authors read and approved the final manuscript Page of (page number not for citation purposes) Health and Quality of Life Outcomes 2009, 7: 24 Additional material Additional...
- 7
- 642
- 0
báo cáo khoa học:" Performance and cross-cultural comparison of the short-form version of the CPQ11-14 in New Zealand, Brunei and Brazil" pps
... validation of the short- form versions was provided in a study of a random population sample of New Zealand adolescents who had completed the full questionnaire This work confirmed that all short- form ... 2010 A Malay version of the short- form CPQ was derived through a forward-backward translation process, then piloted and adapted Ethnicity information was collected from the parent/ caregiver Information ... significant and similar correlations with the ratings of oral health and overall impact on quality of life, although it was lowest in the Brunei sample Discussion Validation of the short- form measures...
- 6
- 264
- 0
ARGENTINA FROM A BRITISH POINT OF VIEW AND NOTES ON ARGENTINE LIFE docx
... estancia of Santa Catalina, 4, 049 hectareas, say 10,002 A strip of land at Guaycuru on the eastern boundary of the Company's forest lands, 1,636 hectareas, say 4, 041 A piece of land at Venado ... Barrancosa RAILWAY COMMUNICATION At the time of the formation of the Company, the nearest railway was that belonging to the Central Argentine Railway, and the nearest railway station was Rosario, ... North-East of San Cristobal), and Las Chuñas, which forms the North-Western corner of the Company's lands Loading Wheat at Rosario from the "Barranca." San Cristobal Estancia House SANTA CATALINA AND...
- 213
- 379
- 0
báo cáo hóa học: " A psychometric evaluation of the PedsQL™ Family Impact Module in parents of children with sickle cell disease" pptx
... United States Census classification and reflect parent report based on the following choices: White, Black, Native Hawaiian or Other Pacific Islander, Asian, American Indian or Alaskan native, ... [17] assesses parent HRQL and family functioning and is intended to measure the impact of a chronic health condition on parents and families It has been shown to be reliable and valid in smaller ... Health and Quality of Life Outcomes 2009, 7:32 http://www.hqlo.com/content/7/1/32 Background Methods Understanding the impact of a chronic disease on a parent and family of a child with a chronic...
- 11
- 552
- 0
Báo cáo y học: " Withdrawal of inhaled corticosteroids in individuals with COPD - a systematic review and comment on trial methodology" ppt
... by two reviewers Again, disagreements were resolved through discussion We extracted data on Analysis We only conducted a meta-analysis on outcome data from trials which we rated as acceptable ... Summary of the way in which trials define and manage exacerbations WISP O’Brien et al COPE COSMIC Definition of exacerbation ’The presence of at least consecutive days of increase in any two ‘major’ ... assess publication bias Limited data within the trial reports meant that we were only able to conduct one meta-analysis Meta-analysis There are reasons for being cautious about the one meta-analysis...
- 10
- 394
- 0
Báo cáo sinh học: " SNP mapping of QTL affecting growth and fatness on chicken GGA1" pptx
... GGGGGAAGACTGCTGCTTAT ATGCCAAACCACCATTGACT AGGGCTGACAGCTGGTTTTA ACTTCCAACAGCCCATTCTG CTGGCTGCAGGAGAGTAAGC AAGCTGCCAAACAAAACCAG CTGCTTGCAGACCTCTAGGC ATACAGGCCAAGCACAGGAA CTTCCCACCAACGTTCTGTT CCAAAGCTCTGAAAGGCAAG ... TGTCCGGAAGAGAAGAGGAA AGCCTGGTTCCATGACAAAC GTGAGCTTCTGTGGTGCAAA CGAGAACCACTCCCATCTGT TGCATGGAGACAACTGGGTA GGGCTCCTGACGTGGTATTA TAGCTGCAGGCGTACAAAGA CCGTGCCCTGTACCTGTAGT AGGCTGAACAGTCCCAGCTA ATATGGGTGTGTGGCCTTGT ... Primer (5 -3 ) AGTGCCTGTGAGGACAAACC CCAATCCACCAAAGATGTCC GAGAGAGCCTCCGCTAATGA GGACAATCTCCTCCCTCTCC ATGTACTGGGACTGCCTTGG TGCCACTTACACAGGTGCTC GTGGGCAAGCTGATGATTTT TGTACCAGTCCCCTCACACA Annealing Product...
- 14
- 312
- 0
140 CHARACTERS A Style Guide for the Short Form
... Communication and consumption must change, because as it stands right now, traditional media is a totalitarian aristocracy, subject to the political whims of the corporate few with power It will change, ... combination of short and instant message services, status appliances, and social networks has created an audience that both is voracious and has a deficit of attention We as readers define the short form ... as we know it is barely a teenager, instant messaging (IM) a toddler, and the short form a mere babe in comparison Social networking was just one of an emerging class of “Web Apps” only a few...
- 210
- 3,112
- 0
báo cáo hóa học: " Validation of a short form Wisconsin Upper Respiratory Symptom Survey (WURSS-21)" pdf
... 342 342 344 322 34 22 3222 44 43 4 42 3 22 24 24 4 43 43 4 32 43 3 244 34 2 34 43 32 42 4 33 343 4 243 44 43332 42 42222 24 33 4 3 34 34 342 33 4 3 42 2 4 24 4 44 32 43 222 23 3 243 4 4 4 344 3 3 24 2 34 333 ... 42 24 34 23 3 23 332 4 3 33 333 34 23 4 44 4 33 24 43 2 244 344 24 244 4 34 42 33 34 43 4 2 33233 343 23 42 3 3 344 4 344 222 24 33 42 3 3 44 34 4 34 32 44 3 44 4 0.0 10.0 40 .0 SF8 Physicial 4 3 4 4 2 4 ... 223 4 3332 242 33 22 2 32 43 2 4 22 43 2 243 242 243 2 23 32 4 22 42 32 343 433 243 23 33 2 44 34 42 3 3332 34 442 3 2 44 4 232 2 43 32 34 24 43 34 24 3 244 34 4 243 2 23 34 44 244 4 24 2 23 4 4 322 4 4 34 33 43 23...
- 20
- 454
- 0
báo cáo hóa học:" Development of the Well-being questionnaire short-form in Japanese: the W-BQ12" pptx
... translation and clinical evaluation Journal of Clinical Experimental Medicine 2000, 192:809-8 14 (a Japanese Journal publishing in Japanese) Cronbach LJ: Coefficient alpha and the internal structure ... item was as intended [9], and the final selection of translation options was made Patients and procedures A questionnaire booklet containing the Japanese 27-item W- BQ, the Japanese Diabetes Treatment ... Linguistic validation The Japanese translation captured the content of the original W- BQ22 with appropriate adaptations to several words where an equivalent Japanese word for the original English...
- 10
- 523
- 0
báo cáo hóa học:" The 12-item medical outcomes study short form health survey version 2.0 (SF-12v2): a populationbased validation study from Tehran, Iran" pptx
... Bullinger M, Alonso J, Apolone G, Leplege A, Sullivan M, WoodDauphinee S, Gandek B, Wagner A, Aaronson N, Bech P, Fukuhara S, Hassa S, Ware JE: Translating health status questionnaires and evaluating ... concepts and framework Medical Journal of the Islamic Republic of Iran 2010, 24: 115-125 Montazeri A, Goshtasebi A, Vahdaninia M, Gandek B: The Short Form Health Survey: translation and validation ... Montazeri A, Farshad A, Kalantari N, Maher A, Golmakani MM, Salehi GH, Motevallian SA, MalekAfzali H: The application of urban health equity assessment and response tool (Urban HEART) in Tehran;...
- 8
- 423
- 0
báo cáo hóa học: " Validation of a proposed WOMAC short form for patients with hip osteoarthritis" ppt
... limitation walking on flat surface”, “pain up/down stairs” and “functional limitation ascending stairs”, and “functional limitation getting in/out of a car” and “functional limitation putting on ... 1997, 50: 247 -252 Auw Yang KG, Raijmakers NJH, Verbout AJ, Dhert WJ, Saris DB: Validation of the short- form WOMAC function scale for the evaluation of osteoarthritis of the knee J Bone Joint Surg ... socks” Convergent and discriminant validity The correlation coefficients between the WOMAC pain and function short scales and the SF-36 domains were all lower than the Cronbach’s alpha of the WOMAC-SF...
- 11
- 449
- 0
báo cáo hóa học:" Validation of a short form Wisconsin Upper Respiratory Symptom Survey (WURSS-21)" pot
... 342 342 344 322 34 22 3222 44 43 4 42 3 22 24 24 4 43 43 4 32 43 3 244 34 2 34 43 32 42 4 33 343 4 243 44 43332 42 42222 24 33 4 3 34 34 342 33 4 3 42 2 4 24 4 44 32 43 222 23 3 243 4 4 4 344 3 3 24 2 34 333 ... 42 24 34 23 3 23 332 4 3 33 333 34 23 4 44 4 33 24 43 2 244 344 24 244 4 34 42 33 34 43 4 2 33233 343 23 42 3 3 344 4 344 222 24 33 42 3 3 44 34 4 34 32 44 3 44 4 0.0 10.0 40 .0 SF8 Physicial 4 3 4 4 2 4 ... 223 4 3332 242 33 22 2 32 43 2 4 22 43 2 243 242 243 2 23 32 4 22 42 32 343 433 243 23 33 2 44 34 42 3 3332 34 442 3 2 44 4 232 2 43 32 34 24 43 34 24 3 244 34 4 243 2 23 34 44 244 4 24 2 23 4 4 322 4 4 34 33 43 23...
- 20
- 497
- 0
Báo cáo y học: "Validity of the International Physical Activity Questionnaire Short Form (IPAQ-SF): A systematic review" docx
... Medicine and Science in Sports and Exercise 2000, 32:S450-S456 28 Ishikawa-Takata K, Tabata I, Sasaki S, Rafamantananatsoa HH, Okazaki H, Okibo H, Tanaka S, Yamamoto S, Shirota T, Uchida K, Murata M: ... Netherlands USA Vietnam Switzerland USA Sweden The Netherlands 12 countries USA Norway Norway Hong Kong, China Canada Belgium Guangzhou, China Australia Australia South Africa Greece Puerto Rico Japan Reference ... regarding validity may vary according to which index and objective measure is used as the standard, for example, both time spent in physical activity and raw count data have been used as a measure...
- 40
- 299
- 0
Employment agreement in letter format (short form)
... If you agree with the above, please sign both copies of this letter in the presence of a witness and return one copy to the Employer Sincerely, [NAME OF EMPLOYER, ex ABC Corporation] Per: ... I have read, understand and hereby voluntarily accept the terms of employment outlined above Date: ………………………………………… Witness ………………………………………… [NAME OF EMPLOYEE] ...
- 2
- 436
- 2
Báo cáo khoa học: Puroindoline-a and a1-purothionin form ion channels in giant liposomes but exert different toxic actions on murine cells pptx
... showing the formation of cationselective ion channels in artificial lipid bilayer membranes and in the plasmalemma of rat hippocampal neurons [ 14] Although a concentration-dependent study of a1 PTH ... Separate pools of the PTH-containing and PIN-containing crude fractions were dialyzed against deionized water and freeze-dried, and a1 -PTH, a2 -PTH and b-PTH were separated (at room temperature) ... concentration or activity and the permeability of each ion species was calculated as previously described [32,33] Patch-clamp data were analyzed off-line with TAC software (Bruxton Corporation, Seattle,...
- 13
- 436
- 0
INSTRUCTIONS FOR FLORIDA FAMILY LAW RULES OF PROCEDURE FORM 12.902(b), FAMILY LAW FINANCIAL AFFIDAVIT (SHORT FORM) (09/12) pdf
... forms and section 61.075(1), Florida Statutes, for definitions of “marital” and “nonmarital” assets and liabilities.) Florida Family Law Rules of Procedure Form 12.902(b), Family Law Financial ... should be listed separately with separate dollar amounts $ Monthly gross salary or wages Monthly bonuses, commissions, allowances, overtime, tips, and similar payments _Monthly business ... if additional pages are attached Total Assets (add next column) wife $ $ B LIABILITIES: Nonmarital DESCRIPTION OF ITEM(S) List a description of each separate debt Current (check correct owed...
- 8
- 347
- 0
ordinary and partial differential equation routines in matlab - h.j. lee & w.e. schiesser
... Ordinary and Partial Differential Equation Routines in C, C++, Fortran, Java®, Maple®, and MATLAB® H .J Lee and W. E Schiesser CHAPMAN & HALL/CRC A CRC Press Company Boca Raton London New York Washington, ... wes1@lehigh.edu) Information for acquiring (gratis) all the source code in this book is available from http://www.lehigh.edu/˜ wes1/ wes1.html Additional information about the book and software is available ... a detailed presentation of stiff (implicit) algorithms and associated software in six languages was judged impractical for a book of reasonable length Further, we have illustrated the application...
- 515
- 548
- 0
measuring risk in complex stochastic systems - j. franke, w. hardle, g. stahl
... 2 0A 0.52 2A 0.52 0.52 3A 0 .47 0 .49 0 .48 4A 0 .45 0 .46 0 .46 0 .42 5A 0 .48 0 .49 0 .48 0 .45 0 .42 6A 0 .48 0 .49 0 .48 0 .46 0 .42 0 .46 7A 8A 0 .45 0 .45 0 .46 0 .41 0 .40 0 .42 0 .42 0.13 9A 1 0A 0 .44 0 .44 0 .45 ... 1A 2A 3A 4A 5A 6A 7A 8A 9A 1 0A 1 1A 1 2A 1 3A 1 4A 1 5A 1 6A 1 7A 1 8A 1 9A 2 0A 2 1A 2 2A 2 3A 2 4A 2 5A 2 6A 2 7A 2 8A 2 9A 3 0A 3 1A 3 2A 3 3A 3 4A 3 5A 3 6A 3 7A 3 8A 3 9A 0.28 0.30 0.27 0.29 0.22 0.29 0.29 0.03 0. 24 ... 0 .40 0.39 0.39 0 .40 0.15 0.39 0.37 1 1A 1 2A 0.50 0.50 0.50 0 .46 0 .45 0 .46 0 .46 0.16 0 .44 0 .43 0 .43 0.37 1 3A 0 .48 0.50 0 .49 0 .45 0 .42 0 .45 0 .45 0.15 0 .42 0 .41 0 .41 0.35 0 .47 1 4A 1 5A Table 1.1: Asset...
- 251
- 601
- 0
- word short form list
- windows presentation foundation terminal server print w encountered a problem
- history of united states of america in short form
- 417 three circuits for g w x y z w × x ×y y × z a two level and or b two l
- 726 master slave j k flip flop a circuit design using s r latches b function table
- 728 edge triggered j k flip flop a equivalent function using an edge triggered d flip
- a dollar late and a day short
- a style guide for the short form
- chapter 4 putting it in practice—a short form project brief
- w w j a lilia href pf45 xị л xu ß a w uw a w a lilia href pf45 „ j i xu xut iß a lilia href pf46 xị a xu vx2 u2w apos a li ul li ul lilia href pf49 mam apos aìamam apos a a lilia href pf4b xu nu e
- in out board and context aware mailing list reuse of a simple widget and evolution to use different sensors
- pilatowsky r j romero c a isaza s a gamboa p j sebastian w rivera cogeneration fuel cell sorption air conditioning systems springer verlag london 2011
- weyenberg w vermeire a vandervoort j remon j p ludwig a 2005 effects of roller compaction settings on the preparation of bioadhesive granules and ocular minitablets european journal of pharmaceutics and biopharmaceutics 59 527 536
- leung s r lin j y l ching k f to e k w ng j y w lau j j y sung 2003 factors predicting progression of gastric intestinal metaplasia results of a randomised trial onhelicobacter pylori eradication gut 53 1244 1249
- 0 96 c tớnh theo nghiờn cu ca cỏc tỏc gi j p h j rutges e h w kruizinga a rosenberg r koole khoa phu thut ming v hm mt trng i hc utrecht netherlands v ỏnh giỏ kt qu chc nng sau iu tr bo tn góy li cu xng hm di nm 2005 cho kt qu tt l 96
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25