barker a l 1918 2002 british novelist and short story writer
Tài liệu Cancer Pain Management: A perspective from the British Pain Society, supported by the Association for Palliative Medicine and the Royal College of General Practitioners docx
Ngày tải lên :
14/02/2014, 21:20
... metastases Myeloma Breast cancer Lung cancer (small and non-small cell) Headache Brain metastases Germ cell tumours Lymphoma and Leukaemias [Breast cancer] [Small cell lung cancer] Abdominal pain Ascites ... treatment in this setting • First line pharmacological approaches include paracetamol and non-steroidal antiinflammatory drugs (NSAIDs) Adjuvant analgesics include skeletal muscle relaxants (diazepam, ... of selected cases (Borgelt, 1981) • Splenomegaly may also be a cause of abdominal pain Typically, this will be due to a haematological malignancy, such as chronic granulocytic leukaemia or lymphoma...
- 116
- 548
- 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot
Ngày tải lên :
07/03/2014, 16:20
... CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CLAP_2:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (A) 48 1870 Fig Nucleotide and deduced amino acid sequence ... CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_1:ATTCTCCTGGCATTAAAGATGGAATGGAGGGAACCACGATGCAAGGAAAGAGTCTCATATTTTCAATCAAAGATGGTGAGGTTATAATCAACAGCAAGAC CLAP_2:ATTCTCCTGGCATTAAAGATGGAATGGAGGGAACCACGATGCAAGGAAAGAGTCTCATATTTTCAATCAAAGATGGTGAGGTTATAATCAACAGCAAGAC...
- 12
- 772
- 0
Owen l astrachan a computer science tapestry exploring programming and computer science with c++ 2nd
Ngày tải lên :
19/03/2014, 14:12
... particular computers Just as translators can translate English into both Japanese and Swahili, so can translating computer programs translate a high-level language into a low-level language for a particular ... and low-level languages, we’ll study how a C++ program is translated into a low-level language The low-level language of 0’s and 1’s that a computer understands is called machine language Because ... was written during a sabbatical year in Vancouver, Canada where the salmon is great, the city is wonderful, and the rain isn’t nearly as bad as people lead you to believe Finally, thanks to Laura...
- 879
- 489
- 0
Asthma WellnessKeeping Children with Asthma in School and Learning Liability & Litigation: A Legal Primer Asthma & Indoor Air Quality (IAQ)Asthma Management, Policies and Procedures.St r a i g h tBy Paul D. Houstont a l kIn School and Healthy: docx
Ngày tải lên :
23/03/2014, 23:20
... www.cdc.gov/nceh/airpollution/asthma/default.htm, 1-888-232-6789 Information and statistical data on asthma; coordinated school health programs American Academy of Allergy, Asthma, and Immunology www.aaaai.org, ... eplater@aasa.org National School Boards Association (NSBA) The National School Boards (NSBA), through its School Health Programs Department, makes available information on asthma prevention and management ... that aggravate asthma are secondhand tobacco smoke, mold, dust mites, cockroaches, animal dander, cleaning supplies and chemicals, pesticides, perfumes and paint The EPA has launched a national...
- 16
- 450
- 0
world of microbiology and immunology vol 1 (a-l) - k. lee lerner
Ngày tải lên :
08/04/2014, 13:12
... Bacteria and bacterial infections ANAPHYLACTIC SHOCK • see IMMUNITY: ACTIVE, PASSIVE, AND DELAYED ANAPHYLAXIS Anaphylaxis Anaphylaxis is a severe allergic reaction The symptoms appear rapidly and can ... SYNDROMES AGAR Agar and agarose AND AGAROSE Agar and agarose are two forms of solid growth media that are used for the culture of microorganisms, particularly bacteria Both agar and agarose act to solidify ... See also Hemorrhagic fevers and diseases; Virology, viral classification, types of viruses; Zoonoses ARMILLARIA Armillaria ostoyae OSTOYAE Armillaria ostoyae is a fungus, and is also known as...
- 366
- 313
- 0
Function of Soils for Hum a n Societies and the Environment .The G e o l o g i c a l Society of L ppt
Ngày tải lên :
06/07/2014, 08:20
... processes, and implications for ecological risk assessment 63 BA~UELOS, G S & LIN, Z.-O Reuse of agricultural drainage water in central California: phytosustainability in soil with high levels of salinity ... salinity and toxic trace elements 79 JANSA,J., WIEMKEN ,A • FROSSARD,E The effects of agricultural practices on arbuscular mycorrhizal fungi 89 BURGHARDT,W Soil sealing and soil properties related ... Society has the power to confer Chartered status on suitably qualified Fellows, and about 2000 of the Fellowship carry the title (CGeol) Chartered Geologists may also obtain the equivalent European...
- 5
- 287
- 0
báo cáo khoa học: " ‘A major lobbying effort to change and unify the excise structure in six Central American countries’: How British American Tobacco influenced tax and tariff rates in the Central American Common Market" doc
Ngày tải lên :
11/08/2014, 14:21
... and Nicaragua, and enjoyed the largest market share in Costa Rica, El Salvador and Panama (see Table 1) [13] Only in Guatemala did PM have a marginally larger market share than BAT In this context, ... Holden and Lee Globalization and Health 2011, 7:15 http://www.globalizationandhealth.com/content/7/1/15 CACM countries BAT’s assessment of PM’s likely strategy was as follows: Guatemala will ... 500053610-500053611 Holden and Lee Globalization and Health 2011, 7:15 http://www.globalizationandhealth.com/content/7/1/15 Page 12 of 12 51 BAT, Guatemala: manufacturing rationalisation http://legacy.library.ucsf.edu/...
- 12
- 259
- 0
A Guide to Microsofl Excel 2002 for Scientists and Engineers phần 1 pdf
Ngày tải lên :
14/08/2014, 06:22
... mathematical applications, such as Mathematica, MathCAD, Maple, etc., but none are as widely available as Microsoft Excel Furthermore, the learning curve for Excel is very gentle; a little learning ... cell and the bottom right cell separated by a colon Since a range may be a one by one block, the word range may also refer to a single cell In a later chapter, we will learn how to reference a ... data and perform calculations Note how the main part of the space is divided by gridlines into rows and columns The smallest unit of space, where a row and a column intersect, is called a cell...
- 34
- 425
- 0
A Guide to Microsofl Excel 2002 for Scientists and Engineers phần 2 pptx
Ngày tải lên :
14/08/2014, 06:22
... C4 will initially display Open the Format dialog and select the Fractions category to adjust this One of the most hailed new features of Excel 97 was called natural languageformulas This allows ... monthly, quarterly and semi-annually.Namedcells and formulas with mixed absoluterelative references will work well here The data validation feature (accessed using PataIValidation from the menu) ... B4 has an integer value so it cannot be made to display any fewer decimal places All the numbers now display one decimal place Click the Decrease Decimals button once to display them all as integers...
- 33
- 505
- 0
A Guide to Microsofl Excel 2002 for Scientists and Engineers phần 3 ppsx
Ngày tải lên :
14/08/2014, 06:22
... parenthesis #N /A N o value is available #NULL! A result has no value #NUM! Numeric overflow; e.g a cell with =SQRT(Zl) when Z1 has a negative value #REF! Invalid cell reference #VALUE! Invalid argument ... type; e.g a cell with =LN(ZI) when Z1 contains text When a cell having an error value is referenced in the formula of a second cell, that cell will also have an error value An error you are sure ... nomenclature Whereas Excel 97 and Excel 2000 users speak about the Paste Function tool and the Formula Palette, Excel 2002 users talk of the Insert Function tool and dialog box Also, the location...
- 33
- 511
- 0
A Guide to Microsofl Excel 2002 for Scientists and Engineers phần 4 pps
Ngày tải lên :
14/08/2014, 06:22
... just a line and the latter as just markers Dynamic Charts If you collect data over a prolonged period you may wish to be able to add data to a worksheet and have a chart automatically updated ... will have a slope equal to the acceleration aand an intercept equal to the initial velocity v, , Example B Consider a body with initial velocity v, acceleratingat a rate a The distance d that ... formulas Users of Excel XP have access to a tool that performs these evaluations more conveniently Make C15 the active cell and use the command ToolslFormula AgditinglEvaluateFormula Click the Evaluate...
- 33
- 330
- 0
A Guide to Microsofl Excel 2002 for Scientists and Engineers phần 5 docx
Ngày tải lên :
14/08/2014, 06:22
... the ability to translate the algorithm into the Visual Basic language Like all languages, both natural and computer, Visual Basic has a set of rules known as the language syntax Figure 8.4 outlines ... an approximation to a parabola If you now carefully examine the first chart you may see that the markers form a shallow quadratic Right click on the trendline and change it from linear to a second-order ... exponent An experimenter has collected the data shown below The basic variable is the length of the fish Two morphological variables - length and surface area of the pectoral fin - have been measured...
- 33
- 397
- 0
A Guide to Microsofl Excel 2002 for Scientists and Engineers phần 6 potx
Ngày tải lên :
14/08/2014, 06:22
... variable and term as a floating-point variable We could this by coding line as Dim term As Double, k As Integer When the data type of variables are not declared Visual Basic uses a special data ... is called parametric anaZysis We could also vary h, There are occasions when we are unsure of the exact value of a variable and make an educated guess at it We might then change that parameter ... The tools on the Forms toolbar are actually a little outdated and have been replaced by those on the Control toolbar These are called ActiveX controls However, they are somewhat more complicated...
- 33
- 350
- 0
A Guide to Microsofl Excel 2002 for Scientists and Engineers phần 7 ppt
Ngày tải lên :
14/08/2014, 06:22
... To value, and (iii) that A1 is the cell whose value is to be changed- the By changing cell Goal Seek changes the value of A until it finds avalue which gives the formula in B1 the value close ... Microsoft Excel 2002for Scientists and Engineers We could vary, for example, A 1 :A and B 1, (iv) Solver permits constraints For example,you can require that a varied cell always has a positive value (v) ... Al:E7 and click the Copy button Move to Sheet5 and, with AI as the active cell, click the Paste button (b) Select A4 :B7 and use InsertlllIamelGreate to name B4:B7, otherwise your formulaswill...
- 33
- 399
- 0
a guide to microsoft excel 2002 for scientists and engineers phần 8 ppsx
Ngày tải lên :
14/08/2014, 06:22
... of calculation to manual A status bar message of Calculate will to recalculate the worksheet remind you when to press Numerical Integration 23 (c) The formula in C3 is =IF(B3> -A3 "3+10 *A3 A2+5 *A3 ,0,1) ... more random numbers would help Alternatively, we could record the result for, say, 20 recalculations and take an average This could be done automatically using a VBA subroutine (f) If you have ... a -k sign) Release the mouse button and tab labelled Sheet2 (2) will appear Delete Sheet3 and rename Sheet2 (2) as Sheet3 (b) Open the Visual Basic Editor with the command ToolsJMacrol Visual...
- 33
- 432
- 0
a guide to microsoft excel 2002 for scientists and engineers phần 9 potx
Ngày tải lên :
14/08/2014, 06:22
... recalculated by pressing [ because we are using manual recalculation mode (d) Enter the value in the Flag cell and press @ The Tvalues will change Repeatedly tap @ and Microsoft Excel will repeat ... in a data set occur within a range of values in a bin Calculates the standard deviation of the values in STDEV a data set Calculates the probability for Student’s tTDIST distribution Calculates ... columns F and G Enter the experimentalvalues in column A Select A3 :A 13 and name A4 :A1 3 as data This will allow the worksheet to be used with up to 10 measurements although we have only seven...
- 33
- 393
- 0
a guide to microsoft excel 2002 for scientists and engineers phần 10 ppt
Ngày tải lên :
14/08/2014, 06:22
... text shown in A :D 19 of Figure 14.9 Enter the experimental values in columns A and B Select A4 :B 19 and use the InsertlEame command to name Al :A1 9 as A and B1:B19 as B This will allow the worksheet ... normal manner In an unused part of the worksheet enter a pair ofx- and y-values in two adjacent cells Values such as and 0.9 will Add these to the chart as a new data series The CopylPaste Special ... thep-value, is applicable when the sets are of unequal size (d) Using IoolslQata Analysis , select the tool t-Test: TwoSample Assuming Equal Variance Set the Hypothetical mean diyerence to and...
- 40
- 353
- 0
dow & saville - a critique of monetary policy; theory and british experience (2001)
Ngày tải lên :
01/11/2014, 22:46
... been taken as revealing a natural law, and his approach has been built on and progressively sophisticated While Leslie DicksMireaux and I got comparable results, these (as we tried to say at the ... Financial Statistics and National Accounts Over time, the value of the stock of financial assets has tended to grow, along with nominal national income and the value of the capital stock Excluding ... them; and the public sector owns real capital considerably in excess of its net debt Including financial assets held and liabilities owned by financial intermediaries, total financial assets are...
- 284
- 323
- 0
A plague o both your houses medicine, power and the great flu of 1918 1919 in britain and singapore
Ngày tải lên :
13/10/2015, 15:54
... correction’ and the ‘jolly rant’ to an illness that closely resembled influenza.17 The French gave their epidemic spells of influenza many names – la baraquette, l allure, la généralle, and la grippe ... Colonial Singapore Health, Disease, and Empire Metropole and Periphery: A Cleaving of Geographical, Epidemiological, and Cultural Spaces Colonial Medical Infrastructure and Responses to State ... action, elite and ordinary, collective and individual, I hope to construct a more “lateral” narrative that this particular pandemic so advocates Hopefully, the story that emerges will be a compelling...
- 107
- 569
- 0