bankruptcy as a political tool

Tài liệu Speaking as a Marketing Tool ppt

Ngày tải lên : 16/01/2014, 22:20

... Plan Marketing - www.actionplan.com Speaking as a Marketing Tool 11 Robert Middleton Interviews Vickie Sullivan speaking as a marketing tool can really create some wonderful and qualified leads ... you, that’s a clue That’s a clue that they are not taking this seriously, that they are not going to help you and you can always back out You can always say, “I am so thrilled that you are pleased ... death because when you say speaker that has such a connotation that they start turning you off You don’t say, “I’m an author, I’m a speaker, I’m a business coach,” you say, “I am a strategic advisor...

40
327
0

Community-Based Social Marketing as a Planning Tool - Community and Regional Planning Masters Project pptx

Ngày tải lên : 29/03/2014, 23:20

... students, and community associations The program worked by offering discounted bus passes to individuals who purchased passes as part of a larger group-purchasing program The discount pass acted as an ... Community-Based Social Marketing as a Planning Tool local, state, and federal government agencies” (Global Action Plan) The U.S program is part of a larger international effort that is operating in ... 18.4% Strangers Other Page 32 5.3% 7.9% September/2002 Community-Based Social Marketing as a Planning Tool Community-Based Social Marketing as a Planning Tool September/2002 Page 33 Chapter Case Studies...

70
425
0

Giving as a Strategic Tool: Short guide

Ngày tải lên : 14/06/2014, 14:14

... WWW.STRATEGY of G I V I N G C O M Giving initiates a movement.  A company that has  generated movement  in the recipients can then  direct this energy SoG WWW.STRATEGY of G I V I N G C O M A company that gives ... most visible. At the same  time, it is the hardest WWW.STRATEGY of G I V I N G C O M Giving process is  only actualized  when the receiver  accepts it WWW.STRATEGY of G I V I N G C O M Receiving a gift always  ... SoG WWW.STRATEGY of G I V I N G C O M How can this be  turned into  a strategy? SoG WWW.STRATEGY of G I V I N G C O M Think backwards WWW.STRATEGY of G I V I N G C O M WWW.STRATEGY of G I...

27
335
0

báo cáo hóa học: " Cultural adaptation into Spanish of the generalized anxiety disorder-7 (GAD-7) scale as a screening tool" pot

Ngày tải lên : 18/06/2014, 19:20

... Hospital Anxiety and Depression Scale (HADS, anxiety domain), and the WHO-DAS II disability questionnaire was calculated Concordance between classification criteria was assessed by inter-rater agreement ... Vindel A: Trastornos de ansiedad, Sociedad Española para el estudio de la Ansiedad y el Estrés (SEAS) 2005http://www.ucm.es/info/ seas/ta/index.htm, (last update: March 7th, 2005; last accessed: ... and to assess the efficacy of psychosocial and psychopharmacological interventions in these patients Many health questionnaire-based instruments allowing clinicians to approach GAD at any healthcare...

11
537
0

báo cáo hóa học: " Considerations for the future development of virtual technology as a rehabilitation tool" doc

Ngày tải lên : 19/06/2014, 10:20

... large physical movements as occurs during flight simulations [27] and gaming We have also observed measurable increases in the variability of head and trunk coordination and increased lateral ... NeuroEngineering and Rehabilitation 2004, 1:13 the remote collaborator (this often is referred to as an avatar); the video and/or audio channel (that facilitates face-to-face conversation.) Video has limited ... of the available fiber has been lit, and each fiber has several terabits/s of capacity The dot-com implosion has made this dark fiber and wavelengths of light in the fiber, very affordable The...

10
449
0

Tài liệu mẫu phân tích IPA Importance performance analysis as a strategic tool for destination attractiveness an analysis of domestic

Ngày tải lên : 01/08/2014, 10:25

... heritage and art forms, local festivals, road drives and activities for children As (1) asserted that it is important to measure consumer satisfaction applying as many destination attributes as ... of their ways of living Aranmula is famous for its ‘metal mirror’ and boat race There are also institutions like the Vaastu Vidya Gurukulam, which gives training in vaastu shastra and a school ... K.,“Tourism: It’s about managing competitiveness, too”, International Trade Forum, 1, 2003 w w w i j m b s c o m [39] Bindu Narayanan, Chandrasekharan Rajendran, Prakash Saia, L, Ram Gopalan,“Dimensions...

7
874
3

Micromanipulation as a Clinical Tool ppt

Ngày tải lên : 05/08/2014, 16:20

... implantation and clinical pregnancy rate may have been Micromanipulation as a Clinical Tool 301 increased following laser-mediated assisted hatching and a relatively large group of healthy babies ... children) was also diagnosed at 18 months in a ooplasmic Micromanipulation as a Clinical Tool 289 transfer infant, a boy from a mixed sex twin Other centers applying ooplasmic transplantation have not ... than 20 babies There are a number of ways to transplant ooplasm, but the one initially used was a minor modiﬁcation of the standard clinical ICSI technique A small portion of ooplasm was transferred...

30
1.3K
1

Báo cáo khoa học: "Evaluation of a Bacillus stearothermophilus tube test as a screening tool for anticoccidial residues in poultry" doc

Ngày tải lên : 07/08/2014, 18:21

... rebmun A la te sisylana DPAR aidnI ,ragantazI ,etutitsnI hcraeseR yranireteV naidnI ,yrotarobaL airetcabocyM eht ta muidem nesneJ-nietsnewoL no deniatniam dna ]62[ stset lacimehcoib dna )gniniats ... sisylana )DPAR( AND cihpromylop deifilpma modnar yb sniarts )CEPA( iloc E cinegohtap naiva fo noitaitnereffiD B S nosnevS ,J najayeerpisaS ,P atoosamaR ,N iahcnropirisnahC 49-58 ,3 ,1991 lppA sdohteM ... gniraeppa dnab AND a fo )0( ecnesba ro )1( ecneserp fo sisab eht no tliub saw dna slaremun eht fo desopmoc xirtam atad A hpargotohp a no deton erew DPAR yb deniatbo snrettap gnidnab ehT )ynamreG...

7
323
0

Báo cáo y học: "Assessing post-traumatic stress disorder in South African adolescents: using the child and adolescent trauma survey (CATS) as a screening tool" docx

Ngày tải lên : 08/08/2014, 21:20

... compare a clinician-assessment with a self-report, we did not consider it imperative that parental collateral be obtained Previous studies have noted that parents may not always be aware of what ... Stellenbosch and Cape Town Consent from the heads of schools, parent bodies, and parents and learners was also obtained Learners and their parents/guardians were informed that participation was entirely ... for categorical data Cohen's kappa coefficients (K) were used to measure the level of agreement between the measures As initial analysis revealed a statistically significant difference and low...

10
667
0

Báo cáo y học: "Validation of the Arab Youth Mental Health scale as a screening tool for depression/anxiety in Lebanese children" ppt

Ngày tải lên : 13/08/2014, 18:21

... the AYMH scale has reasonably good construct validity and internal consistency However, the scale has moderate discriminatory capabilities as a diagnostic tool for depression and anxiety Compared ... check the equality of variance assumption Internal consistency of the scale was evaluated using Cronbach’s alpha As for validity analysis, the diagnostic assessment of depression and anxiety by ... this article as: Mahfoud et al.: Validation of the Arab Youth Mental Health scale as a screening tool for depression/anxiety in Lebanese children Child and Adolescent Psychiatry and Mental Health...

7
386
0

ENVIRONMENTAL PLANNING IN RWANDA ENVIRONMENTAL IMPACT ASSESSMENT (EIA) AS a PLANNING TOOL AND ITS EFFECTIVENESS

Ngày tải lên : 15/04/2015, 09:16

... the authority (REMA) Quality of the EIAs   on the basis that EIA is still new in Rwanda , the latter has been encouraging as many individuals as possible to participate in carrying out EIAs, ... Rwanda   Under the present legislation, several government departments, private companies, and parastatal organisations undertake EIAs; that some forms of environmental assessments have occasionally ... environmental Organic law No 04/2005 of 08/04/200 (2005;  established Rwanda Environmental Management Authority (REMA), to coordinate and oversee all aspects of environmental management for sustainable...

34
332
0

4 ways email fails as a collaboration tool

Ngày tải lên : 27/11/2015, 12:22

... instantly ge sa es m nd se to y wa ick qu a s ay Email was alw munication tool m co ce fi of rd da an st e th e Then it becam And the headaches began Photo by hitsnooze - Creative Commons Attribution-ShareAlike ... ne an ch d an ol to n tio bo lla co ain m Should this be the Watch this video on the ways email is failing us as a collaborative tool Photo by luc legay - Creative Commons Attribution-ShareAlike ... Facebook notifications And SPAM Photo by Lars Plougmann - Creative Commons Attribution-ShareAlike License https://www.flickr.com/photos/75062596@N00 And now, managing email is a major chore Photo...

10
123
0

Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly

Ngày tải lên : 03/04/2013, 21:06

... pleasantness ratings, the aroma concentration had a similar effect on both age groups in the first tasting session: the heightened aroma sample was rated as less pleasant than the regular aroma sample ... Preliminary data analysis revealed no significant main effects and only one significant interaction of day and aroma on the pleasantness ratings of the young, implicating an increase in pleasantness ... a small food reward after the last evaluation session Samples The sample material was a fermented oat bran product (Yosaw, Bioferme, Finland), which is a cereal-based snack food similar to flavored...

10
599
1

Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx

Ngày tải lên : 19/02/2014, 12:20

... Remarkably, we have found that, at least in some circumstances, a quantitative correlation to biophysical data can be obtained from a statistical analysis of selected phage populations [16] We also ... association of the variable heavy chain (VH) with protein A was used as a surrogate for direct stability measurements The VH domains in camelid heavy chain antibodies are most similar to the classical ... denaturant as a selective pressure to The potential for obtaining quantitative biophysical information from phage-display was suggested by a new method called alanine shotgun scanning, which analyzes...

7
502
0

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Ngày tải lên : 19/02/2014, 17:20

... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG ... AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were ampliﬁed The PCR products ... rate to CPK % Product formation changed signiﬁcantly as the PK activity was modulated At increased PK activity we found an almost proportional increase in formate and acetate production and a...

12
616
0

Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc

Ngày tải lên : 21/02/2014, 03:20

... cell spectrum and spectral areas selected by genetic algorithm A smear of about · 105 cells was dried on an area of cm2 on the germanium surface as explained in Materials and methods Wavenumbers ... final model Linear discriminant analysis (LDA) This statistical multivariate method is supervised It searches for the variables containing the greatest interclass variance and the smallest intraclass ... et al assigned the shoulders present at 1117 and 1020 cm)1 to RNA and DNA, respectively [18] Classification by LDA Classification by LDA on spectra reduced by PCA PCA was performed on the training...

6
555
0

microsimulation as a tool for the evaluation of public policies potx

Ngày tải lên : 19/03/2014, 00:20

359
408
0

Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc

Ngày tải lên : 22/03/2014, 12:20

... those measures that are being used in the target areas as well as foreign countries, such as Indonesia, China, Bangladesh, Germany, Mexico, Colombia, USA. Some of them are introduced as follows. ... Table 7. Standardized score for costs of combinations Measure A1 +A2 .3 A1 +B1 A1 +B2 A1 +B1+B2 A2 .1 +A2 .3 A2 .1+B1 A2 .2 +A2 .3 A2 .2+B1 A2 .3+B1 A2 .3+B1+B2 Standardized cost Standardized score ... doing so, the consensus on the problems and their solutions can be reached. However, it is noted that MCA is subjective in its nature. In case the quantitative data are available, quantitative analysis (i.e. numerical ...

13
487
0

Báo cáo khoa học: Mechanisms of amyloid ﬁbril self-assembly and inhibition Model short peptides as a key research tool pptx

Ngày tải lên : 23/03/2014, 11:20

... similar to aromatic DNA-intercalating agents Although DNA is the most important biological assembly stabilized by aromatic interactions [56], a diverse group of planar aromatic compounds can intercalate ... information of the role of aromatic moieties in amyloid fibril formation [36–41] A parameter-free model based on the mathematical analysis of many peptide fragments and their analogues had clearly ... formation E Gazit case a central aromatic region was identified by the nonbiased peptide scan [22] Interestingly, the same motif was independently identified when analyzing peptide fragments [49] As...

8
441
0

báo cáo hóa học: " Video capture virtual reality as a flexible and effective rehabilitation tool" pot

Ngày tải lên : 19/06/2014, 10:20

... other platforms in a number of ways that have great relevance for its use as a tool for rehabilitation evaluation and intervention Some of these characteristics appear to be advantageous whereas others ... rehabilitation Virtual reality applied to rehabilitation Virtual reality has a number of well-known assets, which make it highly suitable as a rehabilitation intervention tool [11] These assets ... Bjorkdahl A, Pascher R, Rydmark M: Virtual reality and haptics as an assessment devise in the postacute phase after stroke Cyberpsychol Behav 2002, 5:207-211 Jack D, Boian R, Merians A, Tremaine...

12
412
0