bacteriorhodopsin a transmembrane protein

Tài liệu Báo cáo khoa học: Hu-K4 is a ubiquitously expressed type 2 transmembrane protein associated with the endoplasmic reticulum ppt

Ngày tải lên : 19/02/2014, 17:20

... 1¢ 2⁄4 3¢ 4¢ 4¢ 5¢ A 105 75 50 35 + - + + Weak Weak > 54 aa aa T C C T G Weak Weak Adequate Weak Adequate aa 58 aa 13 aa 33 aa 31 aa Adequate Adequate aa 24 aa ATG ATG ATG ATG ATG C B αHu-K4 + ... mainly associated with the plasma membrane or with the membranes of intracellular organelles although they lack a transmembrane domain They are attached to the cytoplasmic face of the membranes ... hints at a geranylgeranyl anchor Alternatively, Hu-K4 could harbour a transmembrane domain formed by a stretch of 17 hydrophobic amino acids (Figs 3A and B; psort ii predicts a transmembrane domain...

9
518
0

Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

Ngày tải lên : 15/02/2014, 01:20

... enigmatic as none of the Nir proteins codes for a transmembrane protein that could be a candidate for moving d1 heme, or a precursor, across the membrane Alternatively, as suggested by Suzuki et al ... with the side chain saturated, but accessing these putative substrates is not trivial An alternative approach would be to seek accumulation of the substrate of NirF in a mutant that lacks NirF; this ... SB123 and SB124 The mutants generated in this study are detailed in Table Bacterial strains, plasmids and growth conditions The bacterial strains and plasmids used in this study are detailed in Table...

12
613
0

Tài liệu Báo cáo khoa học: How disorder inﬂuences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx

Ngày tải lên : 18/02/2014, 04:20

... (5Â-TACCGTTAACATCGATATGCATCATCATC ATCATCATGC-3Â) was designed to insert a ClaI restriction site at nucleotide position )6, whereas the reverse primer (5Â-ATCGCCATGGTCCCGGGCATATGGGATC CCTGGAAGTACAGGTTTTCCTTTTTAATGGGTGTC ... ATGGTCCCGGGCATATGGGATCCCTGGAAGTACA GGTTTTCGTCTAGAAGATTTCTGTC-3Â) designed to remove the NTAIL stop codon and to introduce a fragment encoding a TEV cleavage sequence and a NcoI restriction site at position ... two separated reactions yielding products N1 (from nucleotides 1330) and N2 (from nucleotides 331396) N1 was amplied using a forward primer (FWN1: 5Â-TACCG TTAACATCGATATGCATCATCATCATCATCATAC-3Â),...

14
672
0

Tài liệu Báo cáo khoa học: Expression of poly(A)-binding protein is upregulated during recovery from heat shock in HeLa cells doc

Ngày tải lên : 18/02/2014, 12:20

... gcattGTCGACttttttgtaaatttttttggggttttttaaaagatttttttagattttttttg gattttttCTGCAGCAGAGCTCGTTTAGTGAACCG Ccttctccccggcggttagtgctgagagtgc aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa Primer ... PCMV-Sport–b-gal plasmid) CGCTATTACCATGGTGATGC (nucleotides 4588–4608 of PCMV-Sport–b-gal plasmid) CGGTTCACTAAACGAGCTCTGCTGCAGaaaaaatccaaaaaaaatctaaaaaaatcttttaaaa aaccccaaaaaaatttacaaaaaaGTCGACaatgc gcattGTCGACttttttgtaaatttttttggggttttttaaaagatttttttagattttttttg ... β-gal AR S 5’-aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa-3’ (3) TOP-β-gal CMV Transcription start site β-gal Relative abundace of β-gal A PABP expression during heat shock recovery...

19
596
0

Tài liệu Báo cáo khoa học: An alternative transcript from the death-associated protein kinase 1 locus encoding a small protein selectively mediates membrane blebbing pdf

Ngày tải lên : 18/02/2014, 17:20

... anti-GST and anti-Flag (Sigma), and anti-PARP (Cell Signal) The ProteoExtract Subcellular Proteome Extraction Kit (Calbiochem, La Jolla, CA, USA) was used to extract proteins from mammalian cells according ... mRNA level is depicted as a ratio of DAPK-1 ⁄ s-DAPK-1 to actin (E, F) s-DAPK-1, DAPK-1 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA quantiﬁcation in colon carcinoma and rectal carcinoma ... vitro at a faster rate than GST alone (Fig 2E), supporting the existence of a protease that cleaves s-DAPK-1 protein in vivo The reason why the cleavage band was not observed in this assay may be...

11
659
0

Tài liệu Báo cáo khóa học: A multi-protein complex containing cold shock domain (Y-box) and polypyrimidine tract binding proteins forms on the vascular endothelial growth factor mRNA Potential role in mRNA stabilization pptx

Ngày tải lên : 19/02/2014, 12:20

... cells and cardiac myocytes J Mol Cell Cardiol 33, 2179–2187 11 Tanaka, T., Kanai, H., Sekiguchi, K., Aihara, Y., Yokoyama, T., Arai, M., Kanda, R & Kurabayashi, M (2000) Induction of VEGF gene transcription ... IL-2 mRNA [31–33], and general mRNA stabilization [34–37] PTB proteins may also play a role in general mRNA stabilization [62] To investigate a role for the VEGF mRNA CSD/PTB sites, we analyzed ... CSD proteins have been shown to play a role in both induced [31–33] and general [34–37] mRNA stabilization Recent data suggests that PTB proteins may also play a role in this latter type of mRNA...

13
604
0

Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

Ngày tải lên : 21/02/2014, 03:20

... brassicae CSPMbraA6 [32] We observed also that BrC15-Ac was able to displace ASA, suggesting that brominated fatty acid and ASA both associated with W81 in the same ligand binding site The ligand ... Nomura, A. , Kawasaki, K., Kubo, T & Natori, S (1992) Puriﬁcation and localization of p10, a novel protein that increases in nymphal regenerating legs of Periplaneta americana (American cockroach) ... that probably resulted in a compact conformation that was resistant to cleavage CD analysis and oligomerization The far-UV CD spectrum of ASP3c at neutral pH (Fig 5A) displayed a positive peak...

11
642
0

Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx

Ngày tải lên : 22/02/2014, 04:20

... CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGCCCTTCCGGAGAAGA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT ... CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT Length (bp/amino acids) 576/192 468/156 ... yielded protein complexes somewhat smaller on average than those in extracts from Artemia, and by way of comparison, small heat shock /a- crystallin proteins produced in transformed bacteria usually...

10
495
0

Tài liệu Báo cáo Y học: Differential response of neuronal cells to a fusion protein of ciliary neurotrophic factor/soluble CNTF-receptor and leukemia inhibitory factor pot

Ngày tải lên : 22/02/2014, 07:20

... 3027 STAT3 and MAPK activation by Hyper-CNTF in transfected BAF/3 cells Downstream signal transduction pathways were analyzed by studying the activation level of JAK/STAT and MAP kinase signaling ... (even at high concentrations) alone were able to activate the MAPK pathway MAP kinases and STAT3 are rapidly activated within 10 in response to Hyper-CNTF, the phase of activation lasting for at ... was obtained from Amersham International (Aylesbury, UK) X-ray ﬁlms (X-OMAT-AR) were from Eastman Kodak (Rochester, NJ) Cells, cytokines and antibodies PC12 and COS-7 cells (ATCC, Manassas, VA,...

9
442
0

Báo cáo khoa học: Serine-arginine protein kinases: a small protein kinase family with a large cellular presence potx

Ngày tải lên : 06/03/2014, 01:20

... kinases and 1a is negatively affected by interaction with scaffold attachment factors B1 and FEBS J 276, 5212–5227 18 Nakagawa O, Arnold M, Nakagawa M, Hamada H, Shelton JM, Kusano H, Harris TM, ... Hishizawa M, Imada K, Sakai T, Ueda M, Hori T & Uchiyama T (2005) Serological identiﬁcation of adult T-cell leukaemia-associated antigens Br J Haematol 130, 382–390 58 Schenk PW, Boersma AW, Brandsma ... the SR protein kinase of a protozoan, the parasite Trypanosoma cruzi, which displays trans- and cis-splicing and was cloned and characterized in 2003, functions as a bona ﬁde SR protein kinase,...

17
375
0

Báo cáo khoa học: Structure ⁄function analysis of spinalin, a spine protein of Hydra nematocysts doc

Ngày tải lên : 07/03/2014, 12:20

... of dimers A plateau was clearly reached (Fig 4A) , indicating that speciﬁcally dimers, and not larger oligomers, are formed at higher protein concentrations Spinalin that had been treated with ... near-UV were hampered because of aggregation caused by the higher protein concentrations needed Analytical ultracentrifugation A Beckman model XLA analytical ultracentrifuge equipped with absorption ... and isorhizas appear to function as barbs binding the discharged nematocyst to prey or to the substrate Spinalin is a 24-kDa protein that is a constituent of spines and opercula of Hydra nematocysts...

8
473
0

Báo cáo khoa học: Identiﬁcation of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

Ngày tải lên : 07/03/2014, 15:20

... 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT GGATTGAATAAAATATGATA-3¢; Site-2 wt, 5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT TGTCC-3¢; Site-2 mut, 5¢-GCGTCTCACCCTAGTAA TGGTAATGCTCCAAGGGTTTTTGTCC-3¢; ... a further 15 Complexes were separated on 4% nondenaturing polyacrylamide gel The gels were dried and autoradiographed Competitor DNAs used in EMSA analysis were: NF1 wt, 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; ... Slovak Science and Technology Assistance Agency (APVT) Grant 26-002102 and the Slovak Grant Agency (VEGA) 2/3087/23 (to ¨ K L.) The authors thank O Wrange for recombinant human NF1 and N Tanese...

8
426
0

Báo cáo khoa học: NblA from Anabaena sp. PCC 7120 is a mostly a-helical protein undergoing reversible trimerization in solution pot

Ngày tải lên : 08/03/2014, 10:20

... Nakamura, Y., Wolk, C.P., Kuritz, T., Sasamoto, S., Watanabe, A. , Iriguchi, M., Ishikawa, A. , Kawashima, K., Kimura, T., Kishida, Y., Kohara, M., Matsumoto, M., Matsuno, A. , Muraki, A. , Nakazaki, ... predicts a similar helical arrangement for all of the analysed NblA sequences from cyanobacteria as well as red algae Thus, we propose that all NblA-homologous molecules identied so far share a common ... Sugimoto, M., Takazawa, M., Yamada, M., Yasuda, M & Tabata, S (2001) Complete genomic sequence of the lamentous nitrogen-xing cyanobacterium Anabaena sp strain PCC 7120 DNA Res 8, 205 213 15 Schagger,...

8
308
0

Báo cáo khoa học: EmbR, a regulatory protein with ATPase activity, is a substrate of multiple serine⁄threonine kinases and phosphatase in Mycobacterium tuberculosis doc

Ngày tải lên : 16/03/2014, 14:20

... 1078–1085 Sharma K, Chandra H, Gupta PK, Pathak M, Narayan A, Meena LS, D’Souza RC, Chopra P, Ramachandran S & Singh Y (2004) PknH, a transmembrane Hank’s type serine ⁄ threonine kinase from Mycobacterium ... ethambutol Nat Med 3, 567–570 30 Amemura M, Makino K, Shinagawa H & Nakata A (1990) Cross talk to the phosphate regulon of Escherichia coli by PhoM protein: PhoM is a histidine protein kinase and catalyzes ... suggested as one of the targets for a signal transduction pathway mediated by PknA and PknB If so, this pathway could link cell division and peptidoglycan synthesis with arabinogalactan synthesis, another...

11
402
0

Báo cáo khóa học: Functional properties of the protein disulﬁde oxidoreductase from the archaeon Pyrococcus furiosus A member of a novel protein family related to protein disulﬁde-isomerase doc

Ngày tải lên : 16/03/2014, 16:20

... K., Takahashi, M., Sekine, M., Baba, S., Ankai, A. , Kosugi, H., Hosoyama, A. , Fukui, S., Nagai, Y., Nishijima, K., Otsuka, R., Nakazawa, H., Takamiya, M., Kato, Y., Yoshizawa, T., Tanaka, T., ... Natl Acad Sci USA 97, 14257–14262 49 Kawarabayasi, Y., Hino, Y., Horikawa, H., Yamazaki, S., Haikawa, Y., Jin-n., o, K., Takahashi, M., Sekine, M., Baba, S., Ankai, A. , Kosugi, H., Hosoyama, A. , ... horikoshii; Pa, P abissi; Ss, S solfataricus; St, S tokodaii; Ap, Aeropyrum pernix; Ta, Thermoplasma acidophilum; Tv, Thermoplasma volcanium; Fa, Ferroplasma acidarmanus; Tm, Thermotoga maritima; Aa, Aquifex...

12
506
0

Báo cáo Y học: Balanced expression of single subunits in a multisubunit protein, achieved by cell fusion of individual transfectants docx

Ngày tải lên : 18/03/2014, 01:20

... The absorbance was read by TitertekÒ Multiskan (ICN Flow, USA) The amount of IgA present in each supernatant was calculated relative to a standard preparation with known concentration Verification ... Kodak X-OMAT film for 15–60 s Dot blot density was analysed by TOTALLAB gel software (Phonetix, UK) The amount of SC present in each supernatant was calculated relative to a standard preparation ... demonstrated that a sufficient amount of J-chain was available for SIgA complex formation One SIgA-producing clone (SIgA-3) along with pIgA-D and IgA-29 were analysed by SDS/PAGE gel and Western...

6
371
0

Báo cáo khoa học: Dynamin-like protein-dependent formation of Woronin bodies in Saccharomyces cerevisiae upon heterologous expression of a single protein pdf

Ngày tải lên : 23/03/2014, 07:20

... USA) Plasmids and cloning procedures For heterologous expression in yeast, N crassa HEX1 was ampliﬁed from a N crassa cDNA library using PCR with primer pair RE951 (AAGAATTCATGGGCTACTACGA CGAC) ... secondary antibodies applied were obtained from Molecular Probes (Alexa Fluor 594 goat anti-rabbit IgG and Alexa Fluor 488 goat anti-mouse IgG) Acknowledgements We thank F Nargang for the N crassa ... of yeast and bacterial strains were prepared as described elsewhere [23,24] N crassa strain FGSC#987 (St Lawrence 74-OR23- 1A, mat A) was obtained from the Fungal Genetics Stock Center (Kansas City,...

10
350
0

Báo cáo khoa học: IMP1 interacts with poly(A)-binding protein (PABP) and the autoregulatory translational control element of PABP-mRNA through the KH III-IV domain pdf

Ngày tải lên : 23/03/2014, 10:20

... EcoRI-T7-tccaaaaaaaatctaaaaaaatcttttaaaaaa ccccaaaaaaattt-BamHI EcoRI-T7-aaaaaatccaaaaaaaatct-BamHI EcoRI-T7-tctaaaaaaatcttttaaaaaacccc-BamHI EcoRI-T7-ccccaaaaaaatttacaaaaaatc-BamHI EcoRI-T7-ccccaaaaaaattt-BamHI ... EcoRI-T7-aaaaaaaaaaaaaaaaaaaaaaaaaaaaaa aaaaaaaaaaaaaaaaaaaa-BamHI ¨ AARS-4 ¨ AARS-L ¨ AARS-C ¨ AARS-R ¨ AARS-S Poly (A) 50 FEBS Journal 273 (2006) 5678–5690 ª 2006 The Authors Journal compilation ... All plasmids were Table Primers used to create various ARS constructs Primer Sense sequence ARS EcoRI-T7-aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaa ccccaaaaaaatttacaaaaaa-BamHI EcoRI-T7-tccaaaaaaaatctaaaaaaatcttttaaaaaa...

13
466
0

Báo cáo khoa học: Interaction of ostreolysin, a cytolytic protein from the edible mushroom Pleurotus ostreatus, with lipid membranes and modulation by lysophospholipids pptx

Ngày tải lên : 23/03/2014, 21:20

... Q8WZT0) and Pseudomonas aeruginosa (TrEMBL db: Q9I710) It has been speculated that Aa-Pri1, and similar proteins, may have important roles in the initial phase of fungal fruiting, such as hyphae aggregation ... (B) The samples were ultracentrifuged and the sediments and supernatants obtained were analyzed (A) lane 1, Pharmacia low molecular mass standards; lane 2, ostreolysin (noncentrifuged); lane 3, ... Fatty acids Myristic acid Palmitic acid Stearic acid 1.0 0.75 2.0 Lipoproteins and plasma proteins Human plasma Human LDL Myoglobinb : 8a 90 NI 15 40 Egg PtdCho mixtures : with PamOleGroEthyl-PCho,...

12
492
0

Báo cáo khoa học: How does a knotted protein fold? doc

Ngày tải lên : 30/03/2014, 02:20

... funnel at a particular energy represents the chain entropy, resulting in a broad top that indicates the large number of conformations available to the denatured state Natural proteins have evolved ... completely destabilized, the protein would remain as a straight chain with a single knot The mechanical properties of bovine carbonic anhydrase B, a protein that contains a shallow trefoil knot at its ... red and the knotted chain in dark blue (B) Dimeric structures coloured as in (A) YibK is a parallel homodimer, whereas YbeA dimerizes in an antiparallel fashion (C) Topological diagrams indicating...

11
243
0