bacterial asparaginase a potential antineoplastic agent for treatment of acute lymphoblastic leukemia
Báo cáo y học: "Bovine herpesvirus 4 based vector as a potential oncolytic-virus for treatment of glioma" pps
Ngày tải lên :
12/08/2014, 02:20
... University of Padova, Italy 3Department of Pharmaceutical Sciences, University of Parma, Italy 4Department of Animal Health, University of Parma, Italy Authors’ contributions RM: performed the ... Cariparma (Cassa di Risparmio di Parma, Italy) for funding contributions to the project Author details Department of Human Anatomy and Physiology, University of Padova, Italy Department of Neuroscience, ... cord of a cow with astasia Archives of virology 2000, 145(11):2363-2370 Redaelli M, Cavaggioni A, Mucignat-Caretta C, Cavirani S, Caretta A, Donofrio G: Transduction of the rat brain by Bovine Herpesvirus...
- 6
- 232
- 0
Báo cáo y học: "Nebulised heparin: a new approach to the treatment of acute lung injury" pdf
Ngày tải lên :
13/08/2014, 11:22
... Critical Care Vol 12 No Suter The translation of a potentially beneficial effect of inhaled heparin in experimental models of ALI to clinical practice has not yet been achieved; important additional ... heparin administration as rapidly as necessary? How can dosage of the drug be titrated to achieve maximal local effects without the risk of systemic complications? What is the adequate duration ... direction of optimal patient management in this disease [10] Competing interests The author declares that he has no competing interests References Dixon B, Santamaria JD, Campbell DJ: A phase trial of...
- 2
- 350
- 0
Báo cáo y học: "Comparing different thrombolytic dosing regimens for treatment of acute pulmonary embolism" ppt
Ngày tải lên :
13/08/2014, 21:21
... complications and efficacy, as measured by perfusion lung scans, pulmonary angiograms and echocardiograms With this background, Wang and colleagues conducted a randomized, multicenter study to compare ... metaanalysis Arch Intern Med 2002, 162:2537-2541 Wan S, Quinlan DJ, Agnelli G, Eikelboom JW: Thrombolysis compared with heparin for the initial treatment of pulmonary embolism: a meta-analysis of ... thrombolytic therapy for PTE In a retrospective analysis of 104 patients with PTE who receive rt-PA, 20 patients (19%) had major bleeding [4] The most devastating complication is intracranial bleed and it...
- 2
- 196
- 0
![Báo cáo y học: "Behavioral and antioxidant activity of a tosylbenz[g]indolamine derivative. A proposed better profile for a potential antipsychotic agent" pptx](https://media.store123doc.com/images/document/2014_08/09/medium_srr1407504202.jpg)
Báo cáo y học: "Behavioral and antioxidant activity of a tosylbenz[g]indolamine derivative. A proposed better profile for a potential antipsychotic agent" pptx
Ngày tải lên :
08/08/2014, 20:23
... shows antioxidant activity a) The Polar Surface Area (PSA) of a molecule is defined as the area of its van der Waals surface that arises from oxygen and nitrogen atoms as well as hydrogen atoms attached ... TPBIA Low energy conformation and van der Waals surface of comLow energy conformation and van der Waals surface of compound TPBIA Page of (page number not for citation purposes) Annals of General ... concentrations of TPBIA merit further investigation as a potential candidate as an antipsychotic agent with novel and clinically important properties A putative combination of dopaminergic antagonism and antioxidant...
- 7
- 400
- 0
Success as a real estate agent for DUMmIES
Ngày tải lên :
27/03/2014, 01:27
... be available at the drop of a hat largely because agents have trained them to expect service 24 hours a day, days a week The National Association of Realtors ran a huge marketing campaign a few ... a trained agent, the 50/50 arrangement doesn’t change as drastically as it can in the residential arena ߜ You construct your own database Commercial real estate is a database business For example, ... is also one of the most sought-after speakers in the real estate arena He has spoken to agents and managers at the local, regional, national, and international level for most of the large real...
- 380
- 902
- 1
Báo cáo khoa học: "A Self-Learning Agent for Exchanging Pop Trivia" doc
Ngày tải lên :
31/03/2014, 20:20
... “As far as I know, Madonna is still alive.”, as it cannot find any information regarding Madonna’s death 2.3 Input Analyzer and Input Interpreter The Input Analyzer is designed as both domain and ... complex answer focus types such as “personal profile”, “social network” and “relation path”, as well as domain-relevant concepts such as “party affiliation” or “sexual orientation” Finally, the analysis ... o There are two interfaces realizing the clientside of the system: a 3D software application and a web interface The software application uses a 3D computer game engine, and communicates with...
- 4
- 269
- 0
Báo cáo hóa học: " Cathepsin B: a potential prognostic marker for inflammatory breast cancer" ppt
Ngày tải lên :
18/06/2014, 16:20
... University, Giza, Egypt) for her assistance in reviewing and scoring of pathology slides We also thank Ms A Dhiaa Alraawi and Ms Marwa Tantawy (Department of Zoology, Cairo University, Giza, Egypt) for ... Lejeune C, Romain S, Tubiana N, Beedassy B, Martin PM, Serment H, Piana L: Inflammatory carcinomas of the breast: a clinical, pathological, or a clinical and pathological definition? Int J Cancer 1995, ... Mackay A, James M, Hornick JL, Pereira EM, Milanezi F, et al: Caveolin is overexpressed and amplified in a subset of basal-like and metaplastic breast carcinomas: a morphologic, ultrastructural,...
- 8
- 424
- 0
Báo cáo hóa học: " Research Article A Potential Transmitter Architecture for Future Generation Green Wireless Base Station" potx
Ngày tải lên :
21/06/2014, 22:20
... with OFDM signals OFDM is a noise-like signal with a random path in the I and Q plane, any near zero crossings cause large dips in the envelope signal and a large rate of phase change (instantaneous ... mask of the standard The Cartesian ΣΔ clearly outperforms the polar ΣΔ, leading to a lower n requirement for the same ACP The results shown here for n = are reasonable for the WLAN standard (ACP ... shows a spectrum plot of the Cartesian sigma delta at an input power of −7 dB ACP1 indicates the first adjacent channel and ACP2 indicates the second adjacent channel The shaping effect of the...
- 8
- 199
- 0
Báo cáo khoa học: "Electro-acupuncture and Chinese herbs for treatment of cervical intervertebral disk disease in a dog" potx
Ngày tải lên :
07/08/2014, 20:23
... sullirA irasydeH ues ilagartsA xidaR etipsoH ongiL muc airoP ealahpecorcaM sidiolytcartA amozihR gnaT iP iuG 79 eainnamheR xidaR ablA ainnoeaP xidaR sisneniS acilegnA xidaR eazihrrycylG xidaR gnesniG ... xidaR gnuoixnauhC icitsugiL amozihR ealleiruobedeL xidaR imomanniC xetroC sbreH airoP eallihporcaM eanaitneG xidaR irasA xidaR eatatnediB sihtnaryhcA xidaR eaimmocuE xetroC ihtnaroL sulumaR sitnecsebuP ... sitnecsebuP eacilegnA xidaR leahcimraC itinocA rebuT imomanniC sulumaR sitamsilA amozihR sicidaR natnuoM xetroC socoC eairoP muitorelcS inroC sutcurF eaerocsoiD amozihR ataraperP eainnamheR amozihR...
- 4
- 330
- 0
Báo cáo y học: "A double blind, randomized, placebo controlled study of the efficacy and safety of 5-Loxin® for treatment of osteoarthritis of the knee" potx
Ngày tải lên :
09/08/2014, 10:23
... sword of COX-2 selective NSAIDs CMAJ 2002, 167:1131-1137 Singh GB, Atal CK: Pharmacology of an extract of salai guggal ex-Boswellia serrata, a new non-steroidal anti-inflammatory agent Agents Actions ... urine and whole blood of all patients at each visit of the study duration (Table 3) Serum biochemical parameters and haematological parameters were measured using the automated analyzer HumaStar ... some of the parameters, they remained within the normal laboratory range Statistical analyses of these parameters did not identify any statstically significant changes Similarly, haematological and...
- 11
- 498
- 0
Báo cáo y học: "Postoperative peri-axillary seroma following axillary artery cannulation for surgical treatment of acute type A aortic dissection" pps
Ngày tải lên :
10/08/2014, 09:22
... uremic patient bearing a PTFE graft as vascular access J Vasc Access 2001, 2:28-31 19 Sugimoto T, Kitade T, Nishikawa H, Koyama T, Hatta T, Kurisu S: Large perigraft seroma after aortoiliac bypass ... incidence of cannulation-related complications [6,10] Strauch et al [1] reported 14 complications among 284 patients who had axillary artery cannulation for surgery of the proximal aorta, with brachial ... swelling was noted in the right subclavian area a week later, (figure 3) Needle aspiration revealed 50 ml of clear yellow transudate (figure 4), and laboratory analysis was negative for chylous...
- 4
- 430
- 0
Báo cáo y học: "Daptomycin for treatment of methicillin-resistant Staphylococcus epidermidis saphenectomy wound infection after coronary artery bypass graft operation (CABG): a case repor" ppt
Ngày tải lên :
10/08/2014, 10:20
... mellitus, adipositas, nicotine abuse (49 pack years), hypercholersterinemia and performance of PTCA of the left coronary artery in 2002 In the Department of Thoracic-, Cardiac- and Vascular Surgery of ... design of the study and performed the statistical analysis SAM participated in the design of the study and performed the statistical analysis AW participated in the design of the study and performed ... left-ventricular function and ST-elevations in leads II, III and aVF For these reasons, surgical revascularization was indicated The patient had a significant history of arterial hypertension, Type II diabetes...
- 3
- 658
- 0
Báo cáo y học: "Ultrasound guided injection of dexamethasone versus placebo for treatment of plantar fasciitis: protocol for a randomised controlled trial" potx
Ngày tải lên :
10/08/2014, 21:24
... trial as regional anaesthesia will be performed prior to plantar fascia injections Plantar fascia thickening Fusiform thickening of the plantar fascia is a well established feature of plantar fasciitis ... proximal plantar fascia To confirm the diagnosis of plantar fasciitis, the dorso-plantar thickness of the plantar fascia will be measured by ultrasound at a standard location where the fascia crosses ... Biological Impacts of Fluorination: Pharmaceuticals Based on Natural Products In Fluorine and Health: Molecular Imaging, Biomedical Materials and Pharmaceuticals Edited by: Tressaud A, Haufe G Amsterdam:...
- 8
- 352
- 0
báo cáo khoa học: "Percutaneous pedicle screw reduction and axial presacral lumbar interbody fusion for treatment of lumbosacral spondylolisthesis: A case series" pdf
Ngày tải lên :
10/08/2014, 23:20
... history of axial low back pain and a one-year history of radiculopathy The pain was described as out of 10 on average and 10 out of 10 at its worst, of mechanical type, and refractory to conservative ... cases on the basis of preoperative imaging analysis Therefore, a cm paracoccygeal skin incision was made and the presacral approach was performed to place the anterior axial rod as previously ... 46-year-old Caucasian man who presented with a four-year history of axial low back pain and radiculopathy that was described as out of 10 on average and as 10 out of 10 at its worst on an 11point...
- 6
- 342
- 0
Báo cáo y học: " Parenteral lidocaine for treatment of intractable renal colic: a case series" pps
Ngày tải lên :
10/08/2014, 23:21
... Soleimanpour et al Journal of Medical Case Reports 2011, 5:256 http://www.jmedicalcasereports.com/content/5/1/256 Page of Table Visual Analog Scale score at each 10-minute intervala Before treatment ... Case was a 38-year-old Iranian man who was referred to our emergency department because of refractory renal colic (resistant to morphine and NSAIDS) The patient had a history of renal colic, and, ... nonsteroidal anti-inflammatory drugs in the treatment of acute renal colic: a meta-analysis Arch Intern Med 1994, 154:1381-1387 Ferrini R, Paice JA: How to initiate and monitor infusional lidocaine for...
- 4
- 300
- 0
Báo cáo y học: " Targeted infection of HIV-1 Env expressing cells by HIV(CD4/CXCR4) vectors reveals a potential new rationale for HIV-1 mediated down-modulation of CD4" doc
Ngày tải lên :
13/08/2014, 09:21
... EcoRI and HpaI (C): A 240 bp fragment, containing the poly (A) site of SV40, was amplified using (+) TAGCCCGGGATAAGATACATTGATGAGT and (-) TAGGAATTCATCATAATCAGCCATACCAC and cleaved with SmaI and EcoRI ... GGGATATTGATGTCTGTAGAATAGGAGCTTTGTTCCTTGGG and (-) CCCAAGGAACAAAGCTCCTATTCTACAGTCATCAATATCCC produced a 1457 bp fragment with a 1448 bp deletion in Env (pos 6307–7755) It was cleaved with EcoRI and ... in a 4.3 kb fragment Both fragments were ligated into BssHII and EcoRI of pHD1 [7] (B): PCR of pNL4-3 with the terminal primers (+) CATAATAAGAATTCTGCAAC and (-) CAAGTTAACAGCACTATTC and the fusion...
- 15
- 241
- 0
Synthesis of Pichromenes, a Potential Anticancer Agent Using Organocatalyst
Ngày tải lên :
24/06/2015, 08:17
... maintaining the temperature at 100C A white pasty mass appeared soon After all of the alkaline solution was added, the pasty mass was disolved with 60 mL of cold water The product is precipitated ... enantioselective catalyst 20 mol % of this catalyst was used for the condensation reaction in DMF/water at room temperature for days In 1H-NMR spectrum of crude reaction mixture, a small amount of the desired ... proton at 6,64 ppm and 8,03 ppm in 1HNMR spectrum Therefore, we had to change the condition and use other catalysts L-proline is an amino acid which has a chiral center, making it a potential enantioselective...
- 7
- 321
- 1
Regulation of the TRIP BR1 proto oncoprotein a potential therapeutic target for human cutaneous and intracavitory proliferative lesions
Ngày tải lên :
12/09/2015, 08:19
... intracavitary superficial mucosal lesions such as vulvar intraepithelial neoplasia, cervical dysplasia or carcinoma in situ, oral cancer and nasopharyngeal bladder cavity mucosal surfaces, all of ... carcinoma, lung adenocarcinoma, in vitro and tumor ovarian cystadenocarcinoma, formation in mice colorectal carcinoma, renal cell (J.K Cheong et al, carcinoma, osteosarcoma and unpublished data) hepatocellular ... phosphatase 2A (In preparation) CONFERENCE PAPERS Zang Z, et al Proof -of- principal studies of peptides that antagonize the integrator function of TRIP-Br transcription factors for the treatment of...
- 180
- 363
- 0
Báo cáo y học: "Endoscopic laminoforaminoplasty success rates for treatment of foraminal spinal stenosis: report on sixty-four cases"
Ngày tải lên :
03/11/2012, 11:17
... recovery, and shorter duration of hospital stay In this paper we present the results of an open, nonrandomized trial of endoscopic laminoforaminoplasty for the treatment of foraminal spinal stenosis ... [9] Cases requiring complete foraminal decompression may be treated with a combined interlaminar and lateral approach [6] In a report of 65 surgical cases of lumbar foraminal stenosis, laminectomy ... Spinal Cord 1996, 34:644-650 12 Hejazi N, Witzmann A, Hergan K, Hassler W: Combined transarticular lateral and medial approach with partial facetectomy for lumbar foraminal stenosis Technical...
- 4
- 463
- 0