b stressed partially degraded samples can be analyzed against a standard using uv spectrophotometric analysis and the results compared to the results obtained by hplc analysis of the same samples and standard
Báo cáo khoa học: "Density of CD4(+) and CD8(+) T lymphocytes in biopsy samples can be a predictor of pathological response to chemoradiotherapy (CRT) for rectal cancer" ppt
... performed before and after CRT, the longitudinal dimension of the rectal tumor was measured on BE images before (A) and after (B) CRT, and the reduction rate was calculated as (A -B) /A Biopsy samples ... design and data retrieval and analysis KY, KK, ES participated in immunostaining and data analysis HN participated in the management of this study All authors read and approved the final manuscript ... measured by barium enema study before and after CRT, and the ratio of tumor reduction was calculated Histological response grade was evaluated by pathologists according to the definitions in the Japanese...
- 6
- 371
- 0
EU ANTI-DUMPING LAWSUIT AGAINST VIETNAM - WHAT CAN BE LEARNT FROM THE FOOTWEAR CASE
... INTRODUCTION Background to the study In recent years, a great number of bilateral and multilateral trade agreements have been signed between Vietnam and other countries and international organizations, ... with data and information obtained from the Official Journals of the European Union, Action Aids Vietnam, the Vietnam Leather and Footwear Association, official and unofficial reports, various ... normal value with a weighted average of prices of all comparable export transactions - A comparison of normal value and export prices on a transaction -to- transaction basis - a weighted average basis...
- 66
- 538
- 4
Without grammar very little can be conveyed, without vocabulary nothing can be conveyed
... secondary categories Their broad categories of learning strategies include: an active task approach, realization of language as a system, realization of language as a means of communication and ... employed the vocabulary strategies more often than the male did A possible explanation is that the female are said to be more hard working than the male 3.7.2 Strategy use by majors Numbers Strategies ... Similarly, Weinstein and Mayer (1986) (in O’ Malley and Charmot 1990:43) have learning facilitation as a goal and are intentional on the part of the learner The goal of strategy use is to affect the...
- 48
- 1,320
- 0
Without grammar very little can be conveyed, without vocabulary nothing can be conveyed
... secondary categories Their broad categories of learning strategies include: an active task approach, realization of language as a system, realization of language as a means of communication and ... refers to always and usually and the later one refers to sometimes and rarely The questions in the questionnaire will be analyzed one by one in their vocabulary learning strategy groups by counting ... employed the vocabulary strategies more often than the male did A possible explanation is that the female are said to be more hard working than the male 3.7.2 Strategy use by majors Numbers Strategies...
- 35
- 1,830
- 1
EU ANTI-DUMPING LAWSUIT AGAINST VIETNAM - WHAT CAN BE LEARNT FROM THE FOOTWEAR CASE?
... average of prices of all comparable export transactions - A comparison of normal value and export prices on a transaction-totransaction basis - a weighted average basis may be compared to prices of ... EU anti-dumping laws Making comparison between the export price and the normal value in the EU's law is the same as the WTO's It must be fair, specific, shall be made at the same level of trade ... - A4 - BBE - K41 30 Graduation thesis accession, the experience on the EU market may be useful for Vietnam to adapt in the bigger field of the WTO Le Thanh Hai - A4 - BBE - K41 31 Graduation thesis...
- 84
- 544
- 0
ĐỀ THI THỬ ĐẠI HỌC LẦN I NĂM 2013 TRƯỜNG THPT CÙ HUY CẬN Môn TOÁN, Khối A, A1, B và D
... 0.25 1 9a AB.d ( M , AB ) = 3a 2.3 = a 2 ã Theobira SBA =60 Xộttamgiỏcvuụng SAB cú 9a2 SA = AB tan 60 = 3a ị VSABM = 3a = 9a 3(dvtt ) +Tacú S ABM = 0.25 0.25 a1 2 a2 2 (a1 + a )2 a1 , a2 , b1 ,b ẻ ... Gingthngiqua M(7,3) cúvtpt r n ( A, B) ,( A2 + B 0) ị D : Ax + By - A - 3B = 0.Theotrờntacú: ộ A= A - B - A - B d ( I , D) = IH = = A + 12 AB= 1 2B 2 A= A +B +Vi A = ị D : y =3 1 2B +Vi A = ị D :12 ... 2 0.25 S A B I D C M IV. (1im) Gi I = BM ầAC ,suyra I ltrngtõmcatamgiỏc BCD a 18 a ị IM = BM = IC = AC = a 3ị IM + IC = = CM2 3 ị BM ^ AC Mtkhỏc BM ^ SA ị BM ^ ( SAC ) ị ( SBM ) ^( SAC ) 0.25...
- 9
- 466
- 5
Drilling Can Be Fun
... nominate a group If it is uncountable the group repeats the word at the same time, if countable they say the word individually to show that countable nouns can be divided but uncountable ones cannot ... quieter.Let the students this in pairs, too Grammar Drills can even be done to illustrate a grammar point Take countable and uncountable nouns Put the students in groups of four Call out a noun and nominate ... examples Finally here's a drill I used with my class to give them a boost before an exam I say a sentence and they repeat, changing the pronoun and making the sentence negative Example: Teacher...
- 3
- 304
- 0
What can be done
... of the human need around them that they are unable to function professionally It has been called burnout.40 They may also begin to question the value of their role, and be unable to control the ... example, has been a major factor in encouraging the use of Catalan there, and this has enhanced the prestige of the language in other Catalan-speaking areas Service industries and light manufacturing ... Tourism is a good example of a service industry which can bring considerable benefits to an endangered language, as has been seen What can be done? 133 in parts of Switzerland and northern Italy Dolomitic...
- 40
- 436
- 0
Tài liệu Write Data Validation Code That Can Be Reused in Other Classes docx
... abstract class, and it is best described as a hybrid between an interface and a class(see Table 9.3) Like an interface, instances of an abstract class cannot be created directly, and its methods and ... PhoneDatatypes.vb: An Event Handler for the mFax Variable in the CCustomer Class Private Sub mFax_StringValueBeforeUpdate(ByVal pstrValue As String, ByRef pCancel As Boolean) Handles mFax.StringValueBeforeUpdate ... in a finalized state and cannot be used as a base class 13 Declare the two class-level variables: cValidChars and mstrValue Note that both variables are declared as protected This means that the...
- 16
- 360
- 0
Information Contained in EPA’s Regulatory Impact Analyses Can Be Made Clearer pdf
... Evaluation and Office of Air and Radiation, which has four program offices the offices of Air Quality Planning and Standards, Mobile Sources, Atmospheric Programs, and Radiation and Indoor Air and ... the Clean Air Act These RIAs were prepared by EPA’s Office of Air and Radiation and issued between November 1990, the effective date of the Clean Air Act Amendments of 1990, and December 1995.1 ... 1990; and (3) biennially update its estimates of the benefits and costs of the Clean Air Act, beginning in November 1992 In May 1996, EPA drafted a report that examined the benefits and costs of the...
- 21
- 276
- 0
Why do Internet services fail, and what can be done about it? ppt
... mirrored each night to a backup datacenter Unfortunately, the database backup program had not been running for a year and a half because of a configuration problem related to how the database host ... tracking database had been destroyed, and that the machine he or she was about to reimage held the backup copy of that database Understanding how a system will be affected by a change is particularly ... backup (and now only) copy of the database later that evening, before it was realized that the primary copy of the problem tracking database had been destroyed, and that the re-imaging would therefore...
- 15
- 387
- 0
Báo cáo khoa học: The propagation of hamster-adapted scrapie PrPSc can be enhanced by reduced pyridine nucleotide in vitro pdf
... Results The propagating activities of PrPSc in PMCA are remarkably enhanced in the presence of NADPH To see the influence of NADPH on the ability of PrPSc to propagate in PMCA, a serial PMCA protocol ... transferring electrons, the energy class of PrP may change, leading to an unstable status Another aspect may be the potential metal-catalysed oxidation of PrP Reduced Cu+ from Cu2+ by NADPH can ... NADPH and NADP+ can bind the active site of glucose phosphate dehydrogenase competitively to regulate the speed of the pentose phosphate pathway [28] and NADPH also participates in the synthesis of...
- 10
- 342
- 0
The Research Tax Credit’s Design and Administration Can Be Improved potx
... increase by $166,667 These base increases reduce the amount of credit that the taxpayer can earn in each of the next years by $15,167, for a combined total of $45,500.23 As a result, the actual benefit ... that the inaccuracy of the base began to be a problem as early as years after the introduction of the regular credit’s design As of tax year 1992, 60 percent of all credit claimants were already ... of data we used and whether the data related to before or after amendments and IRS exams.25 If the ASC option had been available to these corporations and they chose the credit option that provided...
- 119
- 1,692
- 0
Báo cáo khoa học: Tyrosine-dependent basolateral targeting of human connexin43–eYFP in Madin–Darby canine kidney cells can be disrupted by the oculodentodigital dysplasia mutation L90V ppt
... mutagenic forward primers were used: Y28 6A, 5Â-GATCA TGAATTGTTTCTGTCGCCAGTAACCAGCTTGGCCC CAGGAGGAGACATAGGCG-3Â; LSYTRF, 5Â-GCAAG AAGAATTGTTTCTGTCGCCAGTGAACCGGGTATAT GACAAAGGAGACATAGGCGAGAGGGGAGC-3Â ... in both the apical and basolateral compartments of the culture dishes The MDCK cell monolayer provides a barrier between the apical and basolateral compartments The voltage drop over the membrane ... at C, then 750 lL of the total lysate was combined with 75 lL streptavidinagarose beads (Novagen, Gibbstown, NJ, USA) and incubated overnight on a rotating shaker at C On the following day, beads...
- 14
- 433
- 0
Các chứng bệnh cần bổ sung vitamin A, B và K pptx
... da mềm mại thường thêm vào kem dưỡng da Chất chống ôxy h a đánh b t gốc tự do thể sản xuất mà gây hại cho tế b o Vitamin A giúp cho việc hình thành tế b o da Cách rẻ nhanh uống vào b ng thay b i ... (vitamin A tìm thấy váng s a) , 100g b , 3/4 ớt đỏ, lát d a đỏ Mắt đỏ B n cần: vitamin B Vitamin nhóm B giúp điều chỉnh chất lỏng hốc mắt”, BS Wendy Denning cho biết “Đỏ mắt xảy mạch máu nhỏ b ... 45 hạt óc chó Đối với B1 2 1mcg: th a dầu cá mòi, ½ b t b t ngô nướng, 1g gan b Stress B n cần: Vitamin B Não cần vitamin B để tạo enzyme, protein mà thúc đẩy phản ứng h a học thể Các enzyme cần...
- 6
- 315
- 0
How Vietnamese Attitudes can be Recognized and Confused: CrossCultural Perception and Speech Prosody Analysis
... have the duration from 0.8 to 1s 222 linguistic knowledge of a tonal language: will they be able to separate tonal from attitudinal information? contour, the EXp, OBV and AUT have last syllable ... first and last syllable Their F0 contours rise rapidly from the first syllable and fall down after the second syllable The EXp, OBV have special shape of the last syllable, which rises at the beginning ... French (10 males and 10 females) who have not been exposed to Vietnamese language The test interface gave them the labels and the definitions of the 16 attitudes (in the native language of the listeners)...
- 4
- 405
- 0
báo cáo hóa học:" Human immunodeficiency virus and human papilloma virus - why HPV-induced lesions do not spontaneously resolve and why therapeutic vaccination can be successful" pot
... Madeleine MM, Franceschi S: Prevalence and type distribution of human papillomavirus in carcinoma and intraepithelial neoplasia of the vulva, vagina and anus: a meta -analysis Int J Cancer 2009, 124:1626-1636 ... SHvdB is one of the inventors of the patent and reports to serve as a non-paid member of the strategy team and steering committee of ISA Pharmaceuticals, a biotech company which has licensed the ... Effective treatment of vulvar intraepithelial neoplasia by vaccination against the oncopoteins E6 and E7 of human Page of (page number not for citation purposes) Journal of Translational Medicine 2009,...
- 8
- 634
- 0
Báo cáo sinh học: " This peer-reviewed article was published immediately upon acceptance. It can be downloaded, printed " ppt
... interests Authors' contributions FB performed the substrate nanopatterning by e-beam lithography ABE and SA carried out the PA-MBE growths JM provided the mask patterned by FIB MASG supervised the PA-MBE ... that, in the worst case scenario, might lead to the total failure of the selective growth The factors to account for can be basically summarized into surface roughness, surface cleaning, and adhesion ... oxygen plasma was performed Adhesion of the Ti mask to the substrate A thick Ti layer barely adhered to the GaN substrate material resulted in delamination of the mask during the MBE growth, as shown...
- 16
- 252
- 0
Game on: How gaming can be used to make my product more engaging
... engaging? DESIGNER I can t wait for the next great gaming experience! GAMER ARe YOU MOBILE ARe YOU CASUAL ARe YOU AVID How can I use gaming to make my product more engaging? DESIGNER (or anyone ... http://plagwitz.wordpress.com/2011/05/24/trying-excel-ribbon-hero-2/ SXSW Seth Priebatsch said at the start of his keynote "Building a Game Layer on Top of the World," Jane McGonigal Felicia Day Josh Williams http://www.slideshare.net/firewheel/where-are-we-going-sxsw-2011 ... How I make boring stuff fun? FLASH HTML5 gamification SEO SOCIAL WEB 2.0 gamification the use of game play mechanics for non-game applications, particularly consumer-oriented web and mobile sites,...
- 172
- 366
- 0
Bài 53: Chất lỏng. Hiện tượng căn bề mặt của chất lỏng
... xà phòng + Ta để màng xà phòng nằm ngang: D C A B - Thanh CD b kéo ph a cạnh AB màng xà phòng thu b diện tích lại b) Lực căng b mặt - Hiện tượng CD dịch chuyển giải thích ta cho b mặt chất ... căng b mặt * Khi ta thổi bong b ng xà phòng, b ng không vỡ? - Vì b mặt chất lỏng tồn lực căng b mặt Lực căng b mặt đặt lên đường giới hạn b mặt vuông góc với nó, có phương tiếp tuyến với b ... lỏng a) Thí nghiệm với màng xà phòng - Một khung hình chữ nhật làm dây thép mảnh có cạnh CD di chuyển dễ dàng dọc theo A AD BNhúng thẳng đứng khung vào cạnh BC nước xà phòng lấy nhẹ nhàng ta được1...
- 21
- 871
- 9
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008