b sf and bmp 7 stimulation on collagen type i a2 chain a sma and tlh expression in flss
Báo cáo y học: " Induction of multiple matrix metalloproteinases in human dermal and synovial fibroblasts by Staphylococcus aureus: implications in the pathogenesis of septic arthritis and other soft tissue infections" pdf
Ngày tải lên :
09/08/2014, 08:23
... clearing infections, initiating immune responses, and in tissue remodeling [9] Excessive MMPs cause matrix degradation and joint destruction as in various forms of arthritis [10] Cytokines interleukin ... Blocking of TNF-α and IL-1 inhibits leukocyte infiltration at early, but not at late stage of S aureus -induced arthritis and the concomitant cartilage destruction in rabbits Clin Immunol Immunopathol ... using wild -type S aureus strain 8325-4 and its mutants lacking aureolysin, serine protease, and cysteine protease, demonstrated in a murine SA model that inactivation of the Available online http://arthritis-research.com/content/8/6/R 176 ...
- 14
- 426
- 0
Báo cáo y học: "Transcriptional regulation of matrix metalloproteinase-1 and collagen 1A2 explains the anti-fibrotic effect exerted by proteasome inhibition in human dermal fibroblasts" docx
Ngày tải lên :
12/08/2014, 12:20
... Billerica, MA, USA), anti-β-tubulin (Sigma-Aldrich) primary antibodies, and anti-goat (The Binding Site, Birmingham, UK) or anti-rabbit or anti-mouse (DakoCytomation, Baar, Switzerland) IgG antibodies ... maturation and their catalytic activity is inhibited by tissue inhibitors of MMP (TIMPs) [12,13] MMP-1 or interstitial collagenase unwinds native type I collagen and initiate its degradation, ... was assessed using antiTFIIEα antibodies on unbound fractions Band intensities were quantified and normalized to those obtained with the anti-TFIIEα antibody The increase in P-Smad2 levels in...
- 14
- 286
- 0
Báo cáo y học: " Effects of pro-inflammatory cytokines on expression of kynurenine pathway enzymes in human dermal fibroblasts" pdf
Ngày tải lên :
11/08/2014, 03:20
... GGACGTTCTGTTTGAGAAGTGGTT KAT2 AADAT Sense Anti-sense GGACTCAAGCCTAAAGGCAACTC CACATCTGGCAGCCAACAAG Anti-sense CACTGGCAACATTAATAATGTTGCA KAT3 CCBL2 Sense ACTATCAGCCATCCCCGTTTC Anti-sense AATGAAGCAAAAACGCACAAACT ... acid inhibits alpha7 nicotinic receptor activity and increases non-alpha7 nicotinic receptor expression: physiopathological implications J Neurosci 2001, 21(19) :74 63 -74 73 Zmarowski A, Wu HQ, Brooks ... gammainterferon-stimulated activity J Interferon Res 1986, 6(4):389-396 29 Daubener W, MacKenzie CR: IFN-gamma activated indoleamine 2,3dioxygenase activity in human cells is an antiparasitic and an antibacterial...
- 7
- 457
- 0
Báo cáo y học: "Effects of pro-inflammatory cytokines on expression of kynurenine pathway enzymes in human dermal fibroblasts" pot
Ngày tải lên :
11/08/2014, 06:23
... GGACGTTCTGTTTGAGAAGTGGTT KAT2 AADAT Sense Anti-sense GGACTCAAGCCTAAAGGCAACTC CACATCTGGCAGCCAACAAG Anti-sense CACTGGCAACATTAATAATGTTGCA KAT3 CCBL2 Sense ACTATCAGCCATCCCCGTTTC Anti-sense AATGAAGCAAAAACGCACAAACT ... acid inhibits alpha7 nicotinic receptor activity and increases non-alpha7 nicotinic receptor expression: physiopathological implications J Neurosci 2001, 21(19) :74 63 -74 73 Zmarowski A, Wu HQ, Brooks ... gammainterferon-stimulated activity J Interferon Res 1986, 6(4):389-396 29 Daubener W, MacKenzie CR: IFN-gamma activated indoleamine 2,3dioxygenase activity in human cells is an antiparasitic and an antibacterial...
- 7
- 360
- 0
Tài liệu Báo cáo khoa học: Mixed lineage leukemia: roles in human malignancies and potential therapy pdf
Ngày tải lên :
16/02/2014, 14:20
... fusion protein binds directly to P-TEFb and strongly activates its kinase function (A Benedikt, unpublished data) Activated P-TEFb can be inhibited by the potent CDK9 inhibitor, flavopiridol, an ... growth and stabilizes mitochondria Inhibition of active GSK3 by lithium or other GSK3 inhibitors leads to cell growth, but may block differentiation and cause induction of apoptosis in MLL-rearranged ... second explanation is the inhibitory effect of mostly all GSK3 inhibitors against certain CDKs, including CDK9 [39] As outlined above, inhibition of CDK9 will presumably impair P-TEFb functions...
- 10
- 657
- 0
Báo cáo khoa học: Alternative splicing: role of pseudoexons in human disease and potential therapeutic strategies pot
Ngày tải lên :
06/03/2014, 09:22
... Castaman G, Duga S & Tenchini ML (20 07) Pseudo-exon activation caused by a deep-intronic mutation in the fibrinogen gammachain gene as a novel mechanism for congenital a brinogenaemia Br J Haematol ... Journal compilation ª 2010 FEBS 8 47 Pseudoexons in human disease A Dhir and E Buratti A B C Fig A schematic representation of three different 5¢ss activating mutations in various disease-causing ... Beta-thalassemia in Chinese: use of in vivo RNA analysis and oligonucleotide hybridization in systematic characterization of molecular defects Proc Natl Acad Sci USA 81, 2821–2825 Balz V, Prisack...
- 15
- 467
- 0
Báo cáo khoa học: Expression of cholinesterases in human kidney and its variation in renal cell carcinoma types pdf
Ngày tải lên :
06/03/2014, 22:21
... antiproteinases, protein markers for sedimentation analysis (beef liver catalase and bovine intestine alkaline phosphatase), phenyl–agarose, lectin-free Sepharose 4B and agarosebound concanavalin A, ... explain their wide distribution in tissues and cells [16], including stem cells [ 17] Increasing evidence links these noncatalytic actions with the binding of cholinesterases to several protein partners ... measured in assays including both BW284c51 and Iso-OMPA, was discounted for the calculation of true acetylcholinesterase and butyrylcholinesterase activities Cholinesterase activity is given in nanomoles...
- 11
- 474
- 0
Báo cáo y học: "All-trans retinoic acid suppresses interleukin-6 expression in interleukin-1-stimulated synovial fibroblasts by inhibition of ERK1/2 pathway independently of RAR activation" ppsx
Ngày tải lên :
09/08/2014, 01:22
... retinoids on interleukin-1-beta (IL-1β)-induced expression of Effect synovial fibroblasts IL-6 in of retinoids on interleukin-1-beta (IL-1β)-induced expression of IL-6 in synovial fibroblasts Rat ... by inhibiting the ERK1/2 pathway and subsequent activation of AP-1 and NF-IL-6 in synovial fibroblasts Materials and methods Synovial fibroblast isolation and culture Rat synovial fibroblasts were ... with a commercially available kit according to the recommendations of the manufacturer (Active Motif), as described before [24] After protein quantification with a bicinchoninic acid assay kit...
- 12
- 386
- 0
Báo cáo y học: "Post-translational aging of proteins in osteoarthritic cartilage and synovial fluid as measured by isomerized aspartate" pot
Ngày tải lên :
09/08/2014, 14:20
... cartilage IsoAsp and superficial non-lesioned OA cartilage, between normal cartilage protein and any OA cartilages, and between normal cartilage GAG and any OA cartilages Synovial fluid alterations ... and lesioned OA cartilage regions are presented in Figure 1c, d, demonstrating more intense GAG staining in the deep non-lesioned OA cartilage regions and less intense staining in lesioned cartilage ... this through an examination of deep and superficial cartilage and synovial fluid content of IsoAsp Isomerized aspartate varied by cartilage location and degeneration status We investigated IsoAsp,...
- 9
- 263
- 0
ADAM10 is expressed in human podocytes and found in urinary vesicles of patients with glomerular kidney diseases pptx
Ngày tải lên :
10/08/2014, 05:21
... specific marker proteins (integrin α3β1 or podocin) we confirmed that cells isolated from the urine are podocytes In addition, by intracellular FACS staining using ADAM10 and WT1 as a specific marker ... podocytes (Fig 2A) , which was accompanied by an increased amount of soluble L1 (Fig 2B) In addition with a specific metalloproteinase inhibitor GI254023X (Fig 2C) and ADAM10 specific siRNA (Fig 2D) ... documented with a Zeiss camera (E) Urinary cells were investigated by intracellular FACS staining using WT1 (podocyte specific marker protein) and ADAM10 antibodies Stained cells were analyzed with Cellquest...
- 9
- 216
- 0
Damaged DNA-binding protein 2 (DDB2) protects against UV irradiation in human cells and Drosophila ppt
Ngày tải lên :
10/08/2014, 05:21
... signals, like the induction of Bax and direct inhibition of Bcl2, may synergize with p53-independent signals including the induction of Bim to antagonize Bcl2 function and promote apoptosis This ... likely has a critical role in UV resistance In addition, forced expression of DDB2 in cFLIP-lacking cells (VA13 and XP -A) did not induce cFLIP accumulation, or protection against UV (Fig 6), indicating ... Drosophila also protected this organism against UV irradiation These results support the notion that DDB2-mediated DNA repair may be required in UV resistance In addition, UV irradiation may activate a...
- 14
- 142
- 0
Báo cáo khoa hoc:" Lack of association between sCTLA-4 levels in human plasma and common CTLA-4 polymorphisms" ppsx
Ngày tải lên :
11/08/2014, 07:20
... and autoimmune pancreatitis [25] In a landmark study of SNP analysis within a 330 kb region of chromosome 2q33 containing CD28, CTLA-4 and the ICOS gene regions in type I diabetics, Ueda et al ... Partanen K: Genetic variation in ICOS regulates mRNA levels of ICOS and splicing isoforms of CTLA4 Mol Immunol 20 07, 44:1644-1651 Vigano P, Lattuada D, Somigliana E, Abbiati A, Candiani M, Di Blasio ... Brizzolara R, Simone R, Chiappori A, Milintenda-Floriani F, Pesce G, Bagnasco M: Soluble CTLA-4 in autoimmune thyroid diseases: Relationship with clinical status and possible role in the immune response...
- 4
- 297
- 0
Báo cáo y học: " Histone deacetylase inhibitors induce apoptosis in human eosinophils and neutrophils" docx
Ngày tải lên :
11/08/2014, 08:22
... mechanism of action in eosinophils involves c-jun-N-terminal kinase and caspases and Thus, HDAC inhibitors have anti-eosinophilic and anti-neutrophilic properties and are possible drug candidates ... glucocorticoid-induced apoptosis involves mainly transcriptional activation or repression [39] Mechanistically, inhibition of HDAC activity should lead to increased transcription Treatment with HDAC inhibitors ... not able to detect any increased acetylation of NF-kB p65 in response to TSA in human eosinophils Similarly, inhibition of the PI3K-Akt pathway by pharmacological inhibitors did not modulate TSA-induced...
- 15
- 332
- 0
Báo cáo y học: " Differential cell reaction upon Toll-like receptor 4 and 9 activation in human alveolar and lung interstitial macrophages" pot
Ngày tải lên :
12/08/2014, 11:22
... the findings for BCG-DNA for both AM and IM, i. e high TNF -a induction and absence of IL10 induction in AM contrasting a distinct IL10 response in IM Taken together, these data obtained on mRNA level ... TTACCTACATCATACACTCACAAT TLR2 GCAAGCTGCGGAAGATAATG CGCAGCTCTCAGATTTACCC TLR3 GAATGTTTAAATCTCACTGC AAGTGCTACTTGCAATTTAT TLR4 ATGAAATGAGTTGCAGCAGA AGCCATCGTTGTCTCCCTAA TLR5 GTACAGAAACAGCAGTATTTGAG TCTGTTGAGAGAGTTTATGAAGAA ... moderate response in IM (figure 7A) Interestingly, AM completely lacked IL10 induction upon stimulation with BCG DNA, whereas IM showed a distinct IL10 induction upon TLR9 activation (figure 7C) IL6...
- 15
- 375
- 0
Báo cáo y học: "Relative percentage and zonal distribution of mesenchymal progenitor cells in human osteoarthritic and normal cartilage" potx
Ngày tải lên :
12/08/2014, 15:23
... analysis and interpretation of data, and drafting or critical revision of the manuscript or both SL contributed to acquisition of data, analysis and interpretation of data, and drafting and critical ... therapeutic opportunities concerning both matrix-based cell-containing implants and cell-free in situ regeneration Additional material Additional file 1: Additional data concerning the differentiation ... conception and design, acquisition of data, analysis and interpretation of data, and drafting or critical revision of the manuscript or both CK and RWK contributed to study conception and design, analysis...
- 15
- 370
- 0
Báo cáo y học: "Expression of leukemia inhibitory factor (LIF) and its receptor gp190 in human liver and in cultured human liver myofibroblasts. Cloning of new isoforms of LIF mRNA" pdf
Ngày tải lên :
13/08/2014, 13:20
... portal tracts (Fig 7A) In the cirrhotic liver, the sinusoidal staining was enhanced, whereas a very faint staining was observed in fibrous septa (Fig 7B) Staining adjacent sections with LIF receptor ... In the case of s-LIF-D, initiation at the AUG within exon D would result in a reading-frame shift following the 6th amino-acid (aa) and a termination at aa 88, the resulting protein bearing no ... whereas it is greatly increased in fibrotic liver, in a localization consistent with that of activated myofibroblasts The slightly diffuse staining is suggestive of extracellular matrix deposition...
- 10
- 287
- 0
Báo cáo y học: "Genome-wide promoter extraction and analysis in human, mouse, and ra" potx
Ngày tải lên :
14/08/2014, 14:22
... definition of different methods is described in the text and in Materials and methods Expression microarray and ChIP-chip (ChIP followed by microarray analysis of DNA) technologies have become important ... genome location, overlapping transcripts, UniGene ID, LocusLink ID, and gene name if available Promoter features included TSS location, first donor and acceptor sites if available, corresponding gene, ... attempt to integrate conservation information with de novo first-exon prediction on a genome-wide scale In collaboration with an experimental group (L Stubbs, personal communication), we previously...
- 12
- 253
- 0
Báo cáo sinh học: "Electroporation by nucleofector is the best nonviral transfection technique in human endothelial and smooth muscle cells" pdf
Ngày tải lên :
14/08/2014, 19:22
... Shot chemical transformation kits supplied by Invitrogen (Carlsbad, CA, USA) Bacteria were grown and the plasmid was isolated using GigaPrep kit, QIAGEN (Valencia, CA, USA) Transfection reagents ... compared lipofection, electroporation and PCI at the same experimental settings on human Ao and CoA SMC and EC Electroporation and PCI may prove difficult to use in a clinical setting Regarding ... techniques might offer a therapeutic option and prove suitable for the treatment of cardiovascular disease, and informations regarding optimization of transfection conditions in order to improve...
- 13
- 384
- 0