aya is a excellent student and plays sport very well

Báo cáo y học: " Attention Deficit Hyperactivity Disorder (ADHD) among longer-term prison inmates is a prevalent, persistent and disabling disorder" pdf

Ngày tải lên : 11/08/2014, 16:22

... psychiatric outpatients Finally, the neuropsychological tests were similar as for the other groups Statistical analysis Descriptive statistics summarised demographic data and clinical characteristics ... 6% among healthy controls, thus reflecting a remarkably lower educational level among prison inmates Standardised questionnaires Clinical characteristics of ADHD among adult male prison inmates ... Gunnar Johansson at Norrtälje Prison for invaluable help in administering the screening survey, Monica Hellberg for administrative assistance, and coinvestigators Michaela Wallensteen, Ann-Charlotte...

13
435
1

Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is speciﬁcally induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

Ngày tải lên : 21/02/2014, 01:21

... arabinogalactan consists of 99% D-galactose and 0.3% L-arabinose and is predominantly linear Potato arabinogalactan consists of 86% D-galactose and 6.6% L-arabinose, while soy arabinogalactan consists of ... D-galactose and D-galacto-oligosaccharides The calculated areas for D-galactose and D-galacto-oligosaccharides were expressed as percentages of the area of mM D-galactose A niger b-1,4-endogalactanase ... Standard methods were used for other DNA manipulations, such as Southern analysis, subcloning, DNA digestions, and lambda phage and plasmid DNA isolations [23] Chromosomal DNA was isolated as...

9
669
0

Getting Started With ASP.NET ASP.NET is a new and powerful technology for writing dynamic web pages.

Ngày tải lên : 06/11/2013, 00:15

... JSP is also very powerful, faster than ASP, and instantly familiar to Java programmers It allows the Java program to leverage the aspects of the Java2 platform such as JavaBeans and the Java libraries ... support via something known as the Java Virtual Machine (JVM), and there are several standard and non-standard tags that are used to add Java applets to a web page These tags tell ... Windows NT and many Unix versions, and it can be built as an Apache module and as a binary that can run as a CGI When built as an Apache module, PHP is especially speedy A downside is that you have...

792
596
0

Tài liệu .An ARCO Book ARCO is a registered trademark of Thomson Learning, Inc., and is used herein under pptx

Ngày tải lên : 20/01/2014, 20:20

... Graduate Management Admission Test, which is a standardized exam given at various locations in the United States and Canada and around the world Throughout North America and in many international ... a margin as any candidate in the state’s history (C) having been reelected with as wide a margin as any candidate in the state’s history (D) she was reelected with as wide a margin as any candidate ... as wide of a margin as any candidate in the state’s history (A) she was reelected with as wide of a margin as any candidate in the state’s history (B) she had been reelected with as wide of a...

696
1K
1

Tài liệu Chapter 19. Mail and Address Book Email is a fast, cheap, convenient communication medium. pptx

Ngày tải lên : 21/01/2014, 06:20

... they're easy to set up and maintain, and because they offer many of the same features as IMAP servers Luckily, Mail can read and send email through Exchange servers as though your Mac were just another ... a fifth kind, but if you follow the instructions at http://members.aol.com/adamkb/aol/mailfaq/imap/applemail.html, you can read your AOL mail as if it came from a regular IMAP account.) POP accounts(Post ... Mail on the laptop, you'll find your messages and attachments already in place IMAP servers (Internet Message Access Protocol) are newer and have more features than POP servers, but aren't as...

5
383
0

Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

Ngày tải lên : 14/02/2014, 19:20

... and 5-CTGAGGGAAGCAAG AATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATC AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATG AGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3 Acknowledgement ... (Duchefa, Haarlem, The Netherlands) Tissues were cleared in ethanol and visualized with a stereomicroscope (Leica MZ16FA) RNA isolation and real-time quantitative RT-PCR analysis RNA was isolated ... PTI1-4 (At2g47060) was cloned in the pBD-GAL4 cam (Stratagene, La Jolla, CA, USA) and were each used as bait to screen an Arabidopsis pACT2 cDNA library [36] The yeast strain PJ69- 4A [37] containing...

11
700
0

Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf

Ngày tải lên : 15/02/2014, 01:20

... forming a cavity 11 A in height The size of this cavity is comparable with that of adeninelacking cobalamins, and thus allows the damaged 4940 Materials Crystalline AdoCbl was a gift from Eisai ... densitometric analysis Therefore, it was demonstrated that bands i and vi are (aDbDcD)2Ỉ(aRỈaRbR) and (aDbDcD)2Ỉ(aRỈaRbR)2 complexes, respectively We named the former the enzymreactivase (1 : 1) complex and ... release of adenine-lacking cobalamins, such as CN-Cbl and damaged cofactor The fact that the relative efﬁciencies of metal ions for the reactivation are not always correlated with the ATPase activity...

13
620
0

Tài liệu Báo cáo khoa học: Golgi reassembly stacking protein 55 interacts with membrane-type (MT) 1-matrix metalloprotease (MMP) and furin and plays a role in the activation of the MT1-MMP zymogen pdf

Ngày tải lên : 18/02/2014, 04:20

... transfected with pCDNA3.1 Zeo+ and MT1/MYC (lane 2), pCDNA3.1 Zeo+ and GRASP55F (lane 3) and MT1/MYC and GRASP55F (lane 4) were immunoprecipitated with the FLAG M2 monoclonal antibody and the associated ... Zeo+ and MT1/ MYC (lane 1), pCDNA3.1 Zeo+ and GRASP55F (lane 2), pCDNA3.1 Zeo+ and MT1 LLY/MYC (lane 3), GRASP55F and MT1 LLY/MYC (lane 4) and GRASP55F and MT1/MYC (lane 5) were immunoprecipitated ... permeabilized and stained with polyclonal antibodies against furin and GRASP55 Arrows show examples of membrane compartment containing GRASP55 and furin Scale bar = 10 lm C GRASP55 Furin contrast,...

18
603
0

Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

Ngày tải lên : 19/02/2014, 05:20

... GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC GCGGGATCCCTGGACGGGCAGCCGATGAAG ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ... GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT ... AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG...

14
517
0

Tài liệu Báo cáo khoa học: "TREATMENT OF LONG DISTANCE DEPENDENCIES IN LFG AND TAG: FUNCTIONAL UNCERTAINTY IN LFG IS A COROLLARY IN TAG" ppt

Ngày tải lên : 21/02/2014, 20:20

... holds, where sy is a string in a, or f = v and e E a The functional uncertainty approach may be characterized as a localization of the long distance dependencies; a localization at the level of ... E T W O FORMALISMS We have compared LFG and TAG analyses of long distance dependencies, and have shown that what functional uncertainty does for LFG comes out as a corollary in TAG, without going ... linguistic relevance may be found in (Kroch and ao hi [51) 2.1 X brooc FEATURE STRUCTURE BASED TREE ADJOINING GRAMMARS (FTAG) In unification grammars, a feature structure is associated with a node...

8
608
0

Pitch and throw, grasp and know - what is a synonym

Ngày tải lên : 02/03/2014, 04:25

... Jump and leap r, soa nd ya Fl and doze an d sle ep Richness and depth are what synonyms raise when they’re used in a paragraph, Sentence, or phrase A lovely and pretty and beautiful city A cat ... Rink: What Is a Noun? and Hairy, Scary, Ordinary: What Is an Adjective?, and of Rainbow Soup: Adventures in Poetry He lives in Cleveland, Ohio BRIAN GABLE is the illustrator of Dearly, Nearly, ... what is a synonym? / by Brian P Cleary; illustrated by Brian Gable p cm — (Words are categorical) eISBN: 1-57505-907-X English language—Synonyms and antonyms—Juvenile literature I Gable, Brian,...

33
2K
0

Peptidylarginine deiminase (PAD) is a mouse cortical granule protein that plays a role in preimplantation embryonic development docx

Ngày tải lên : 05/03/2014, 17:20

... with anti-PAD V (N) and LCA, and (I – L) double labeled with ABL2 and LCA All anti-PAD V labeling is shown in green, except in A where it is red DNA stain in A is green ABL2 labeling is green and ... and J – L) of zona intact 8-cell embryos (A – F) and blastocysts (G – L) labeled with LCA (red) and ABL2 (green) A and D show the LCA labeling in the zona pellucida (arrowhead) B and E show ABL2 ... III, PAD IV, and ePAD) have been cloned and sequenced in mice PAD II is found in various tissues including skeletal muscle, uterus, spinal cord, salivary glands, and pancreas [43] PAD I and PAD...

22
519
0

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Ngày tải lên : 07/03/2014, 05:20

... TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC Table Yeast strains used in this study Strain Genotype ... mutagenesis Primer Sequence (5¢- to 3¢) Vps4–DEL F Vps4–DEL R Vps4–TRP F Vps4–TRP R Vps4–RDF F Vps4–RDF R TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA ... other meiotic clade AAA ATPases and have the AAA domain helix and the C-terminal helix, but not the b domain The distinguishing feature of members of the meiotic clade of AAA ATPases is the SRH motif,...

23
490
0

Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx

Ngày tải lên : 07/03/2014, 17:20

... and a sense cDNA probe (complementary to the antisense) for mouse Slc1 2a2 mRNA were designed as follows; Slc1 2a2 antisense, 5¢-ATCTTCACAAGAAAAAT CACCTGGTACCAAGGATGT; Slc1 2a2 sense, 5¢-ACAT CCTTGGTACCAGGTGATTTTTCTTGTGAAGAT ... genes and connective tissue patterning Development 121, 693–705 16 Ozaki H, Watanabe Y, Takahashi K, Kitamura K, Tanaka A, Urase K, Momoi T, Sudo K, Sakagami J, Asano M et al (2001) Six4, a putative ... S, Nagahama H, Shu Y, Hoshi S, Nakayama K, Nakayama KI & Nagata M (2002) Glomerular differentiation in p27 and p57 double-mutant metanephroi Anat Embryol 206, 31–36 Sung KW, Kirby M, McDonald...

16
476
0

Báo cáo khoa học: A DmpA-homologous protein from Pseudomonas sp. is a dipeptidase speciﬁc for b-alanyl dipeptides Hidenobu Komeda and Yasuhisa Asano docx

Ngày tải lên : 07/03/2014, 21:20

... L-Ala-(Gly)2 (L-Ala)2, L-Ala-D-Ala, L-Ala-D-Ala-L-Ala, DL-Ala-DL-Asn, DL-Ala-DL-Ile, DL-Ala-DL-Leu, DL-Ala-DL-Met, DL-AlaDL-Phe, DL-Ala-DL-Ser, DL-Ala-DL-Val, L-Asp-D-Ala, L-Pro-Gly, L-ProL-Phe, c-Aminobutyryl-L-His ... L-Ala-pNA D-Ala-NH2 L-Ala-NH2 D-Ala-(Gly)2 L-Ala-(Gly)2 b-Ala-L-Ala b-Ala-Gly b-Ala-NH2 b-Ala-L-His (Carnosine) b-Ala-L-Leu (b-Ala)2 similarity to that from dmpA of O anthropi LMG7991 DmpA has been ... Pseudomonas aeruginosa and Lactobacillus delbrueckii ssp lactis DSM 7290 Van der Drift and Ketelaars have isolated a bacterium hydrolyzing b-Ala-l-His (l-carnosine) and identiﬁed it as P aeruginosa...

10
406
0

What is a Mouse-Trap Car and How does it Work? pdf

Ngày tải lên : 16/03/2014, 12:20

... car that travels faster, farther and wastes less energy The most common area where surface friction will occur is between the axle and the chassis The interface between the axle and the chassis ... air is affected by fluid friction and a block sliding on a table is mainly affected by surface friction as well as a little air resistance The greater the amount of friction between two surfaces, ... of all right triangles Ancient mathematicians found that all right triangles are proportional by ratios of their sides and angles These ratios times the angle are known as sine, cosine, and tangent...

15
699
3

Báo cáo khoa học: Ki-1⁄57 interacts with PRMT1 and is a substrate for arginine methylation pptx

Ngày tải lên : 16/03/2014, 13:20

... Identiﬁcation and characterization of two putative human arginine methyltransferases (HRMT1L1 and HRMT1L2) Genomics 48, 330–340 Yanagida M, Hayano T, Yamauchi Y, Shinkawa T, Natsume T, Isobe T & Takahashi ... RACK1 and is a substrate for the phosphorylation by phorbol 12-myristate 13-acetate activated protein kinase C J Biol Chem 279, 11444–11455 12 Ozaki T, Watanabe K-I, Nakagawa T, Miyazaki K, Takahashi ... protein methylation Adox, lyzed and fractionated in nuclear (lanes and 4) and cytoplasmic (lanes and 3) fractions Ki-1 ⁄ 57 was immunoprecipitated (lanes 1–4) and then submitted to methylation by...

16
367
0

Báo cáo khoa học: EmbR, a regulatory protein with ATPase activity, is a substrate of multiple serine⁄threonine kinases and phosphatase in Mycobacterium tuberculosis doc

Ngày tải lên : 16/03/2014, 14:20

... suggested as one of the targets for a signal transduction pathway mediated by PknA and PknB If so, this pathway could link cell division and peptidoglycan synthesis with arabinogalactan synthesis, another ... cell division Eur J Biochem 269, 1078–1085 Sharma K, Chandra H, Gupta PK, Pathak M, Narayan A, Meena LS, D’Souza RC, Chopra P, Ramachandran S & Singh Y (2004) PknH, a transmembrane Hank’s type ... characterization and localization Microbiology 147, 2307–2314 12 Gopalaswamy R, Narayanan PR & Narayanan S (2004) Cloning, overexpression, and characterization of a serine ⁄ threonine protein kinase...

11
402
0