awesomest no that whole title is not a typo
Tài liệu Báo cáo khoa học: Bacitracin is not a specific inhibitor of protein disulfide isomerase pptx
... A. -R Karala and L W Ruddock bacitracin contains at least nine different peptides, of which bacitracin A is the most abundant, and it is mainly used as an antibiotic against infections caused ... propose that bacitracin should not be regarded as a specific inhibitor of PDI Results Bacitracin does not inhibit the catalysis of disulfide bond formation and isomerization by PDI PDI is a catalyst ... thiol–disulfide exchange enzymes, Escherichia coli DsbA and DsbC, as well as the isolated catalytic a domain of PDI Both the PDI a domain and DsbA have a catalytic site, with an associated substrate-binding...
- 9
- 620
- 0
''''This Is Not a Game'''': Immersive Aesthetics and Collective Play pdf
... disappointment at this announcement evaporated, however, when phone calls and instant messages from an anonymous source began claiming that the Majestic fire was arson and part of a larger and dangerous ... disclaimer [5] As you can imagine, an audience that is quite used to being told "This is not a game" does not back off easily, and they are currently still investigating the 8March2003 (non)game ... unfolding of the answers IS the narrative that has me hooked… a meta-narrative" [20] In another editorial "Meta Mystery," Maria Bonasia, a twentysomething Massachusetts-based playwright, discussed "the...
- 10
- 583
- 0
Báo cáo khoa học: "MIX Is Not a Tree-Adjoining Language" doc
... F(aa¯ a, aaaa) a ¯ ¯ A( a, a) F (a , aa) a ¯ A( a, a) D (a , aa) a ¯ E (a a, aaa) a ¯ ¯ D (a , aa) a ¯ C(ε, #) A (¯ , a) a ¯ D(ε, ε) F (a , aa) a ¯ A( a, a) D(ε, ε) E(¯ , a) a ¯ D(ε, ε) A (¯ , a) ... A, A , C, D, E, F}, Σ = {a, a, #}, and P consists of the following rules: S(x1 y1 , y2 x2 ) ← D(x1 , x2 ), C(y1 , y2 ) C(ε, #) ← S(aa¯ aa¯ , #¯ a aaa) a a a a D(aa¯ aa¯ , aa¯ aaa) a a ¯ a ... alternatives In this paper, we prove that MIX is not a treeadjoining language Our proof is cast in terms of the formalism of head grammar (Pollard, 1984; Roach, 1987), which is known to be equivalent...
- 9
- 374
- 0
odysseus is not a hero
... killed at Cyclops¹ because he was being greedy.III) Odysseus is cold-hearted A) He kills people without giving them a chance 1) Suitors 2) Disloyal maids B) He doesn¹t care about people 1) Elpenor ... this.Outline I) Introduction A) The average definition for a hero B) What Odysseus is like compared to the definition C) Odysseus isn¹t a hero II) Odysseus is self centered A) He doesn¹t take ... prevent deaths of crew membersIV) Odysseus is disloyal A) He had affairs with other women 1) Calypso 2) Circe B) Wife didn¹t betray him 1) with suitors 2) even though he was thought to be dead V)...
- 2
- 408
- 0
Đề tài " A new application of random matrices: Ext(C red(F2)) is not a group " ppt
... for all separable unital C ∗ -algebras A Anderson [An] provided in 1978 the first example of a unital C ∗ -algebra A for which Ext (A) is not a group The C ∗ -algebra A in [An] is generated by the ... example of a C ∗ -algebra A for which Ext (A) is not a group Introduction A random matrix X is a matrix whose entries are real or complex random variables on a probability space (Ω, F, P ) As in [T], ... pπ (a) π(b)p = pπ (a) pπ(b)p = u (a) u(b) Thus, u : A0 → B(H) is a unital ∗-homomorphism, which extends u0 , and u (A0 ) is a C ∗ -sub-algebra of B(H) It remains to note that u (A0 ) is gener1 ated, as...
- 66
- 378
- 0
Báo cáo khoa học: "Age is not a limiting factor for brachytherapy for carcinoma of the node negative oral tongue in patients aged eighty or older" docx
... 14 Kawashima M, Kagami Y, Toita T, Uno T, Sugiyama M, Tamura Y, Hirota S, Fuwa N, Hashimoto M, Yoshida H, Shikama N, Kataoka M, Akuta K, Sasaki K, Tamamoto T, Nemoto K, Ito H, Kato H, Yamada S, ... elderly patients is available Generally, local treatment is more appropriate than systemic therapy for the elderly Standard chemotherapy, especially combination treatment, is not encouraged Yamazaki ... 465 Kajiicho Kawaramachi Hirokoji, Kamigyo-ku, Kyoto 602-8566 Japan Department of Radiology, National Hospital Organization, Osaka National Hospital, Hoenzaka 2-1-14 Chuo-ku, Osaka city, Osaka 540-0006...
- 7
- 367
- 0
Báo cáo khoa hoc:" Quantitative competitive reverse transcription polymerase chain reaction is not a useful method for quantification of CD4 and CD8 cell status during HIV infection" pptx
... numerical values Intact mRNA was successfully extracted from as little as 400 µl of whole blood, comparable amounts to that obtained from infants via heelstick This mRNA was used to quantify the amount ... Palo Alto, CA) were chosen that span introns of CD4 and CD8 genes in order to avoid amplification of cellular DNA contaminating RNA preparations Products are generated from cDNA and deletional ... sequences are: Sense 5'GGTGAAGGTCGGAGTCAACG3', Antisense 5'CAAGTTGTCATGGATGACC3' Discussion Our results indicate that there is no correlation between CD4 and CD8 mRNA levels and numbers of cells expressing...
- 4
- 319
- 0
Báo cáo y học: "Early postoperative hyperglycaemia is not a risk factor for infectious complications and prolonged in-hospital stay in patients undergoing oesophagectomy: a retrospective analysis of a prospective trial" ppsx
... data collection, data analysis and writing of the manuscript JHDV participated in data analysis and writing of the manuscript JBH participated in the design of the study, data collection, data ... from (cardio)vascular disease because ASA class or was a prerequisite for inclusion in the study, and only 11% had a history of coronary artery disease It could thus be hypothesized that, in a population ... Hyperglycaemia has vasoconstrictive effects [22], which may aggravate tissue ischaemia, particularly in patients with obstructive vascular disease Insulin has been reported to have vasodilatory...
- 6
- 368
- 0
Báo cáo y học: " Minimal acupuncture is not a valid placebo control in randomised controlled trials of acupuncture: a physiologist''''s perspective" pps
... acupuncture analgesia is probably associated with its counter-regulation of spinal glial activation, PTX-sensitive Gi/o protein-mediated and MAP kinase-mediated signal pathways, and downstream ... analgesia: I: The scientific basis Anesth Analg 2008, 106:602-610 Okada K, Kawakita K: Analgesic Action of Acupuncture and Moxibustion: A Review of Unique Approaches in Japan Evid Based Complement Alternat ... Self- appraisal The brain modulates processes involved in self-appraisal during acupuncture For example, when a patient sees an acupuncturist, there is anticipation of a specific effect [3843] This...
- 9
- 469
- 0
A Project is Not a Black Box docx
... other alternative courses of action has no value to the decision-maker On the other hand, the option to abandon a project has value if there is a chance that demand for a product will not meet ... at t = now has a positive NPV We can verify this result by noting that the NPV from part (a) (without the option to abandon) is -$526, and the value of the option to abandon is $11,270 so that ... However, decision trees are not complete solutions to the valuation of real options because they cannot show all possibilities and they not inform the manager how discount rates can change as we go...
- 17
- 233
- 0
Tài liệu THIS DISPOSTION IS NOT CITABLE AS PRECEDENT OF THE T.T.A.B04/3/02 Paper No. 12 RFC docx
... next article mentions that particular vitamins are ingredients in a skin cream for use with skin that has been damaged by wind, sun or shaving Another excerpt notes that a particular company sells ... only a representative sampling from a larger number of such registrations revealed by his search Ser No 75/934,127 Applicant filed a Notice of Appeal with the Trademark Trial and Appeal Board, along ... its application are completely unrelated to those set forth in the registration cited as a bar to registration of applicant’s mark The Examining Attorney was not persuaded by applicant’s arguments,...
- 8
- 416
- 0
Báo cáo y học: "Natural antisense transcripts with coding capacity in Arabidopsis may have a regulatory role that is not linked to double-stranded RNA degradation" ppt
... thaliana A comparison of the arrangements of overlapping gene pairs in Arabidopsis A comparison of the arrangements of overlapping gene pairs in Arabidopsis thaliana A and A' label the start and end ... prediction and identification of cis-natural antisense transcripts in Arabidopsis thaliana Genome Biol 2005, 6:R30 Kiyosawa H, Yamanaka I, Osato N, Kondo S, Hayashizaki Y: Antisense transcripts with FANTOM2 ... Jotham J, May S: NASCArrays: a repository for microarray data generated by NASC's transcriptomics service Nucleic Acid Res 2004:D575-D577 NASCA Arrays: Affymetrix ATH1 arrays database [http:// affymetrix.arabidopsis.info/narrays/experimentbrowse.pl]...
- 10
- 234
- 0
Is there a duty not to reproduce
... of a situation in which they are aware of the risk that ‘harm’ may arise, but they argue that the disorder is a late-onset disorder, as a consequence not manifesting itself for many years Again, ... blind and deaf The allegation was made that one doctor had acted negligently in failing to treat rubella infection Also it was claimed that another doctor had either negligently mislaid a blood sample ... all, A man who knows nothing of death or nothingness cannot possibly know whether that is so’ (227 A 2d 689 at 711) Finally, the Court of Appeal held that section 4(5) of the Congenital Disabilities...
- 12
- 485
- 0
Báo cáo Y học: Regulation of RAS in human platelets Evidence that activation of RAS is not sufficient to lead to ERK1-2 phosphorylation pot
... does not impair primary activation of human platelets Biochem J 318, 207–212 23 Kojima, H., Shinagawa, A. , Shimizu, S., Kanada, H., Hibi, M., Hirano, T & Nagasawa, T (2001) Role of phosphatidylinositol-3 ... isoform ki- and N-RAS was not excluded [5] Activated RAS was detected with an anti-(pan RAS) Ig, which does not distinguish the various isoforms of RAS In Regulation of RAS in platelets (Eur J Biochem ... RAS that is unable to bind RAF is still able to induce cytoskeletal rearrangements through activation of the small G protein RAC [30] and is able to regulate PtdIns3K [31] Relocalization of RAS...
- 7
- 436
- 0
Báo cáo khoa học: Insulin is a kinetic but not a thermodynamic inhibitor of amylin aggregation pot
... indicate that insulin may be not only a natural inhibitor of amylin aggregation, but also a contributor to the amyloid formation and pathogenesis of T2D We also found that the promotional effects ... amylin degradation under normal circumstances, as amylin cannot be degraded by enzymes such as insulin-degrading enzyme after the formation of fibrils [16] However, when amylin cannot be degraded ... effect on amylin aggregation Samples were incubated at 37 °C for 72 h with shaking, and were taken for ThT assays, light scattering assays and HPLC analysis at selected time points ThT assay To monitor...
- 7
- 388
- 0
Báo cáo khoa học: A new sulfurtransferase from the hyperthermophilic bacterium Aquifex aeolicus Being single is not so simple when temperature gets high potx
... codons for panD and aq477, they appear to be organized as an operon panD encodes an aspartate decarboxylase which catalyses the decarboxilation of aspartate to produce b-alanine, a precursor ... cysteinemodifying reagent, iodoacetamide to verify that Cys69 is required for ST activity All the activity disappeared at a : molar ratio (iodoacetamide Aq-477) This demonstrates that Cys69 is: (a) involved ... substrates All the kinetics show a MichaelisMenten behaviour and the parameters are summarized in Table Clearly, it appears that polysulde sulfur was a very efcient sulfur donor, indicating that...
- 16
- 442
- 0
Báo cáo khoa học: Cyclosporin A-induced oxidative stress is not the consequence of an increase in mitochondrial membrane potential doc
... plate reader Statistical analysis Data were analyzed using prism for Windows (GraphPad Software, Inc., San Diego, CA) Two-way ANOVA was used for assessment of dose–response experiments (Figs and ... cells to CsA Elzinga et al showed that Ca2+ uptake by mitochondria isolated from renal cortical cells of rats that had been treated with CsA for weeks was significantly lower than Ca2+ uptake by mitochondria ... mitochondria isolated from control rats [35] It was not investigated whether there was an increased concentration gradient as a consequence of prior intramitochondrial Ca2+ accumulation If this was the...
- 10
- 455
- 0
Báo cáo khoa học: "Optimization in Coreference Resolution Is Not Needed: A Nearly-Optimal Algorithm with Intensional Constraints" ppt
... it is related to another markable that is already member of the set) it is verified that it is compatible with all members of the set A markable i is compatible with a coreference set if, for all ... succeeding markable? This is linguistically implausible Pronouns are acting as a kind of local variables A ’he’ at the beginning of a text and a second distant ’he’ at the end of the text hardly tend ... possible is preferred distance in sentences and markables part of speech of the head of the markables the grammatical functions parallelism of grammatical functions the heads match or not where is...
- 9
- 436
- 0
22. There is only a chair ............... leg was broken. a. whose b. which c. when d. that a 23. potx
... which isn’t really a fish, it has no brain, no bones and no face a isn’t b a c it d bones c Grammar and Vocabulary 11 How many expressions have you studied in this book so far? a now b presently ... Pronunciation a great b cheap c sea d plead a a station b kation c notion d nation b a plough b cough c lough d hough a a ago b ashamed c assign d atom d a servant b service c verse d very d a ... a 19 My aunt, you met at my birthday’s party, is a teacher a whose b that c whom d both b & c are correct c 20 She was so afraid missing the plane that she took a taxi the airport a...
- 43
- 574
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25