aw in the security defenses of a system or a network for
Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc
... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R A A A A A A A A A A R R R R R R R R R R A A A A A A A A A A A A A A A A A A A A A ... Maniatis, T (1989) Molecular Cloning: A Laboratory Manual 2nd edn Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, USA Fermani, S., Ripamonti, A. , Sabatino, P., Zanotti, G., Scagliarini, ... association phase; the beginning of the dissociation phase is marked by the arrow on the right The experimental data were analyzed using global tting assuming a : interaction with BIAEVALUATION 3.1 Table...
- 8
- 494
- 0
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
... concentrations in the 5–40 lM range Linearity was ensured by monitoring product formation Ó FEBS 2003 at four time points for each reaction (product formation was linear for at least 20 min, at all ... constant of eight was used for the protein [39] A significant speed-up of the calculations was achieved by calculating pKa values for only a subset of the titratable groups in the protein The subset ... Sciences, USA questioned on the basis of studies of chitinase A from S marcescens [23], but convincing evidence for the formation of an oxazolium ion intermediate in b-N-1-4-acetylhexosaminidases has...
- 10
- 651
- 0
Báo cáo khoa học: Key substrate recognition residues in the active site of a plant cytochrome P450, CYP73A1 ppt
... 5¢-GAGTTTGGTTCGATGACAAGGAATGTTG-3¢ 5¢-GTTCGAGAACAATGAATGTTGTGTTC-3¢ 5¢-GAACACAACATTCTCTGTTCTCGAACC-3¢ 5¢-GAAGTTAAAGATACAATGATTCAGCTC 5¢-CATTGTTGAAGACATCAATGTTG-3¢ 5¢-CTTTACATTGTTGAATTCATCAATGTTGCAGC-3¢ ... 5¢-CAACATTGATGTCTTCAACAATG-3¢ 5¢-GCTGCAACATTGATGAATTCAACAATGTAAAG-3¢ 5¢-CTGCAACATTAGCGTTTTCAACAATG-3¢ 5¢-CATACGGAGCATGAGGGTTTCCTTG-3¢ 5¢-CGGGATCGCCATTTCGAGACGGAGGG-3¢ 5¢-CGGGATCGCCATAAAGAGACGGAGGG-3¢ ... 5¢-TCCGTATGGCGAAACCGCTTCTAGTC-3¢ 5¢-GATACCGATGAGATGGGTGGGCAGTTTAG-3¢ 5¢-CAACATTCCTTGTCATCGAACCAAACTC-3¢ 5¢-GAACACAACATTCATTGTTCTCGAAC-3¢ 5¢-GGTTCGAGAACAGAGAATGTTGTGTTC-3¢ 5¢-GAGCTGAATCATTGTAACTTTAACTTC-3¢...
- 12
- 380
- 0
Báo cáo khoa học: Odorant binding protein has the biochemical properties of a scavenger for 4-hydroxy-2-nonenal in mammalian nasal mucosa doc
... the protein was realized as reported above for the recombinant forms of porcine and bovine OBP The purification of the protein was obtained by affinity chromatography with a Ni-NTA Agarose (Qiagen, ... concentration of AMA Competitions between HNE and AMA are shown for porcine (C) and bovine (D) OBP Protein samples were incubated with a fixed saturating amount of AMA and increasing HNE Each point ... ⁄ PAGE of the purified forms of recombinant porcine and bovine OBP gave two single bands at the expected molecular masses Binding capacity was tested using the fluorescent ligand 1-aminoanthracene...
- 12
- 386
- 0
Báo cáo khoa học: "Retrieval of an embolization coil accidentally dislodged in the descending aorta of a dog with a patent ductus arteriosus" doc
... desu neeb evah steksab ralucsav llams dna serans yrruC ,)ASU ,ekaL raeB etihW ,anevorciM( eranS kcenesooG ztalpmA eht ,enicidem namuh nI elbaliava era sloot laveirter etairporppa taht laitnesse ... giF( ecnadiug cipocsoroulf gnisu yretra ditorac eht ta decalp htaehs eht hguorht detresni saw )A3 giF ;ASU ,tosoR( pit lian eriw-eerht a htiw specrof ydob ngierof a ,htaehs eht gnicalp retfA eriw ... ypocsoroulf lanimodba eht fo noitcejorp laretaL siht fo etar sseccus eht etad oT ADP llams a htiw sgod gnuoy ni ymotocaroht ot evitanretla evitceffe dna elpmis a si ,lioc noitazilobme na gnisu ,ADP...
- 3
- 280
- 0
Báo cáo khoa học: "Malignant mixed tumor in the salivary gland of a cat" potx
... tumors of the salivary gland in humans, the most common epithelial-origin tumor was squamous cell carcinoma or adenocarcinoma, whereas the most common nonepithelial tumor was chondrosarcoma [10] ... several categories [7] Malignant mixed tumors, carcinomas and sarcomas have been observed in veterinary cases of pleomorphic Malignant mixed tumor in the salivary gland of a cat 333 adenoma, and several ... realize there was a problem prior to the sudden increase in the size of mandibular gland Salivary gland carcinosarcomas are extremely rare; therefore, there is no well-established therapeutic approach...
- 3
- 302
- 0
Báo cáo toán học: "The number of elements in the mutation class of a quiver of type Dn Aslak Bakke Buan" pps
... on a triangulation If α is a diagonal in a triangulation, then mutation at α is defined as replacing α with another diagonal such that we obtain a new triangulation This can be done in one and ... 1: The mutation class of D4 It is know from [FZ3] that the mutation class of a Dynkin quiver Q is finite An explicit formula for the number of equivalence classes in the mutation class of any ... defined in Section 2, in the An case It was also shown that a cluster-tilting object in the cluster category C corresponds to a triangulation of the regular (n + 3)-gon in the An case In [T] it was...
- 23
- 300
- 0
Báo cáo y học: "A case-control study of rheumatoid arthritis identifies an associated single nucleotide polymorphism in the NCF4 gene, supporting a role for the NADPH-oxidase complex in autoimmunity" doc
... all information regarding genetic factors, antibodies and matching variables was available This same sample set was used for the frequency analysis of rs729749 We used the SAS software for Windows ... 71% and 72%, respectively, are female; the mean age was 51 ± 13 years in cases and 54 ± 12 in controls Information about RF and anti-CCP antibody status was available for 1,315 of the patient samples; ... preparation, statistical analyses and drafted the manuscript A- KL participated in the design of the study and the statistical analyses HK and LA performed the logistic regression analysis LP and...
- 11
- 475
- 0
Báo cáo y học: " A solitary primary subcutaneous hydatid cyst in the abdominal wall of a 70-year-old woman: a case report" pptx
... from the patient for publication of this case report and any accompanying images A copy of the written consent is available for review by the Editor -in- Chief of this journal Figure Image of the ... useful in rendering the diagnosis, showing the size, localization, relationship to adjacent organs, and type of the cyst It can also be used to search for another hydatid location [1,4] The radiological ... totally excised hydatid cyst Acknowledgements The authors thank the patient for providing her written consent for the publication of this case report We also thank IbnMajdoub Hassani Soukaina...
- 3
- 303
- 0
Báo cáo khoa hoc:" Perfluorodecaline residue in the anterior chamber of a patient with an intact crystalline lens: a case report" ppt
... Perfluorodecaline may also have a role in the etiology of some changes, such as corneal oedema and deep corneal vascularization in the area of perfluorodecaline-endothelial contact It is known that ... operation (a and b) Giant retinal tear with shallow detached retina involving the macula in the right eye (c) Reattachment of retina after vitrectomy sis, but could not obtain these results as the ... perfluorodecaline is aspirated from the anterior chamber [3] It is assumed that mechanical or the barrier effects of perfluorodecaline may cause the loss of cell density and morphological changes For...
- 3
- 310
- 0
Báo cáo y học: "Technetium-99m scan in the laparoscopic management of a misdiagnosed Meckel’s diverticulum: a case report" docx
... biochemical parameters and urinalysis The patient had a long history of recurrent abdominal pain From the age of 12, he started occasionally having mild abdominal pain located mostly in the right ... from the Tc-99m scan are uncertain for the diagnosis of a MD, a diagnostic laparoscopy should be performed The safety and efficacy of diagnostic but also therapeutic laparoscopy are widely accepted ... diverticulum and intestinal duplication Semin Pediatr Surg 1999, 8:202-208 Okazaki M, Higashihara H, Saida Y, Minami M, Yamasaki S, Sato S, Nagayama H: Angiographic findings of Meckel’s diverticulum: the...
- 4
- 360
- 0
A STUDY IN THE SELECTIVE POLYMORPHISM OF a AND b GLYCINE IN PURE AND MIXED SOLVENT
... diagram for urea crystals grown in solution [17] The reaction coordinate, , is the angle the dipole vector CO of urea molecules make with the surface normal of the crystal slab For such a simple, ... prone to caking [1], induce poor flow characteristics or give rise to difficulties in the handling or packaging of material Polymorphism of a crystalline material can also affect its solid-state properties ... to scale up the simulation towards the thermodynamic limit Also, algorithms have to be implemented to parse the data, and make sense of the information The aim of the present work is to introduce...
- 170
- 358
- 0
Characteristics of flow in the wake region of a bluff vertical cylinder in the presence of waves,currents and combined wave current flows 2
... simulation Again, in combined waves and currents, flow reversal take place in each wave cycle, but with addition of currents, the vortex is more substantially formed in the flow of the forward half ... discrete vortices are formed in the wake over each wave cycle These discrete vortices appear in an asymmetrical formation, as shown in Figure 136, for the case of C = 50 mm/s, T = 0.7s The vorticity ... 114 of Chapter Based on the above observations, it is clear that the spatial features of the flow around and in the wake of the bluff upstream cylinder remain invariant over successive wave period...
- 108
- 275
- 0
Characteristics of flow in the wake region of a bluff vertical cylinder in the presence of waves,currents and combined wave current flows 1
... was ascertained that: a The forces on the in- line direction of the cylinder varies in a same manner as the flow velocity, for the range of Uc / Uw , b Transverse force signatures were absent at ... locations of the wave tank Table 17 Monitored wave heights as a percentage of original wave height for various mesh sizes Table 18 Comparison of inline forces and transverse forces on downstream cylinder, ... separate vortex resonance and galloping acting alternately a = Vortex Resonance alone b = Galloping alone c = Combined vortex resonance and galloping d = Separated vortex resonance and galloping...
- 195
- 474
- 0
Characteristics of flow in the wake region of a bluff vertical cylinder in the presence of waves,currents and combined wave current flows 3
... velocities measured at y = offset, at spacing of (a) ½ D, (b) D, and (c) ½ D for combined wave and currents of T = 0.7 s, H = 25 mm, C = 50 mm/s 319 Plots of Kinematics in the Wake of Upstream Cylinder ... measured at y = 0.6 D offset, at spacing of (a) ½ D, (b) D, and (c) ½ D for combined wave and currents of T = 0.7 s, H = 25 mm, C = 50 mm/s 320 Plots of Kinematics in the Wake of Upstream Cylinder ... velocities measured at y = offset, at spacing of (a) ½ D, (b) D, and (c) ½ D for combined wave and currents of T = 0.7 s, H = 25 mm, C = 50 mm/s 321 Plots of Kinematics in the Wake of Upstream Cylinder...
- 64
- 231
- 0
Characteristics of flow in the wake region of a bluff vertical cylinder in the presence of waves,currents and combined wave current flows 4
... (At Stable Beating Downstream cylinder spacing at x = ½ D, y = 0.6 D) Figure H8 Iso surface plots of wave only run, T = 0.7s, at time intervals of T (At Steady State Downstream cylinder spacing ... T=0.7s, at time intervals of T’ (At Stable Beating Downstream cylinder spacing at x = ½ D, y = 0) Figure H12 Iso surface plots of wave only run, T = 0.7s, at time intervals of T’ (At Steady State ... surface plots of wave and currents run, C =50mm/s, T =0.7s, at time intervals of T’ (At Stable Beating Downstream cylinder spacing at x = ½ D, y = 0.6 D) Figure H6 Iso surface plots of wave and...
- 57
- 228
- 0
2D Modeling of thermokinetics coupled with heat and mass transfer in the reduction zone of a fixed bed downdraft biomass gasifier
... advantages In fact, it is comparatively a cheap and practical facility for biomass gasification [6], and it is also known for the production of syngas with low tar content Banapurmath and Tewari ... investigation of the important operational parameters on the dynamic behavior of 289 the reactor, particularly the structure of the reaction front and quality of the producer gas Giltrap et al ... biomasses and different agricultural wastes) in a downdraft gasifier to assess the feasibility of animal wastes gasification and the suitability of the producer gas for the running of an IC engine...
- 11
- 665
- 0
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx
... AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR1 7-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT ... obtained from pJH2-SSTR2 by homologous recombination introducing the c-myc -OR1 7-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and ... yeast cells following the hot acidic phenol procedure RT-PCR was performed on DNAsetreated RNA extracts Primers used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢)...
- 14
- 473
- 0
War Bonds in the Second World War: A Model for a New Iraq/Afghanistan War Bond? docx
... certificates of deposit (CDs) of financial institutions Today, savings bonds are almost always a substitute mechanism for other forms of personal savings Author Contact Information James M Bickley ... War Bonds in the Second World War: A Model for a New Iraq/Afghanistan War Bond? Summary The high costs of fighting the wars in Iraq and Afghanistan have rekindled congressional interest in the ... Congressional Research Service War Bonds in the Second World War: A Model for a New Iraq/Afghanistan War Bond? more than $54 billion was in the form of War Savings bonds E bonds alone accounted for $33.7...
- 7
- 361
- 0
Tìm thêm: khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008