automatic acquisition of a large subcategorization dictionary from corpora
Báo cáo khoa học: "Automatic Acquisition of Named Entity Tagged Corpus from World Wide Web" pot
... learning approach, which is moreattractive because it is trainable and adaptable, andsubsequently the porting of a machine learning sys-tem to another domain is much easier than that of a rule-based ... procedures and NE instances arefinally annotated with the appropriate NE categories.This automatically tagged corpus may have lowerquality than the manually tagged ones but its sizecan be almost ... plan to ap-ply more sophisticated natural language processingschemes for automatic generation of more accurateNE tagged corpus.AcknowledgementsThis research was supported by BK21 program of Korea...
- 4
- 397
- 0
Tài liệu Báo cáo khoa học: "AUTOMATIC ACQUISITION OF SUBCATEGORIZATION FRAMES FROM UNTAGGED TEXT" doc
... AUTOMATIC ACQUISITION OF SUBCATEGORIZATION FRAMES FROM UNTAGGED TEXT Michael R. Brent MIT AI Lab 545 Technology Square Cambridge, Massachusetts 02139 michael@ai.mit.edu ABSTRACT This ... extracting lexical and especially collocational information from text has risen dra- matically in the last two years, as sufficiently large corpora and sufficiently cheap computation have ... immediately to the right of a main verb. Adverbs and adverbial phrases (including days and dates) are ignored for the pur- poses of case adjacency. A noun-phrase that sat- isfies the Case Filter...
- 6
- 416
- 0
Báo cáo khoa học: "Automatic Acquisition of Adjectival Subcategorization from Corpora" docx
... Proceedings of the 43rd Annual Meeting of the ACL, pages 614–621,Ann Arbor, June 2005.c2005 Association for Computational Linguistics Automatic Acquisition of Adjectival Subcategorization from Corpora Jeremy ... Conference on Language Re-sources and Evaluation, pages 1499–1504, Las Pal-mas, Canary Islands, May.E. Briscoe, J. Carroll, Jonathan Graham, and Ann Copes-take. 2002. Relational evaluation schemes. ... study of easy adjec-tives and related nouns. Computational Linguistics,18(3):269–309.Daisuke Kawahara and Sadao Kurohashi. 2002. Fertil-ization of Case Frame Dictionary for Robust JapaneseCase...
- 8
- 390
- 0
Tài liệu Báo cáo khoa học: "Creating a Multilingual Collocation Dictionary from Large Text Corpora" docx
... unableto create a complete analysis of a sentence, theFips parser returns chunks of partial analyses. If132Creating a Multilingual Collocation Dictionary from Large Text Corpora Luka Nerima, ... V-Prep-N.Another argument in favour of a full syntacticalanalysis is that it solves the problem of all cases of extraposed elements, such as passives, topicalisa-tion, and dislocation. To illustrate ... expres-sions, based on a detailed linguistic analysis. Theoriginality of our approach comes from the factthat collocations are not extracted from raw texts,but rather from syntactically parsed texts....
- 4
- 479
- 0
Báo cáo khoa học: "Automatic Acquisition of Ranked Qualia Structures from the Web" potx
... po-tential fillers of qualia roles.Yamada and Baldwin (Yamada and Baldwin, 2004)present an approach to learning Telic and Agentiverelations from corpora analyzing two different ap-proaches: one relying ... Telic and Agentive rela-tions.Figure 2: Average ratings for each qualia roleThere also exist approaches specifically aiming atlearning qualia elements from corpora based on ma-chine learning ... the automatically learnedqualia structures are reasonable from an intuitivepoint of view, we also performed an a posteriori893Clue PatternSingular a( x) x is made up of ” NPQTis made up of...
- 8
- 378
- 0
Báo cáo khoa học: "Automatic Acquisition of English Topic Signatures Based on a Second Language" potx
... sense-tagged corpus,the TWA Sense Tagged Data Set, manually pro-duced by Rada Mihalcea and Li Yang (Mihalcea,2003), from text drawn from the British NationalCorpus. We calculated a ‘supervised’ ... MachineTranslation, pages 101–112.Rada Mihalcea and Dan I. Moldovan. 1999. An auto-matic method for generating sense tagged corpora. In Proceedings of the 16thConference of the Amer-ican Association ... Association of Artificial Intelligence.Rada Mihalcea. 2003. The role of non-ambiguouswords in natural language disambiguation. In Pro-ceedings of the Conference on Recent Advancesin Natural Language...
- 6
- 471
- 0
Báo cáo khoa học: "Automatic construction of a hypernym-labeled noun hierarchy from text" docx
... amount of memory. With 50,000 nouns, we would initially require a 50,000 x 50,000 array of values (or a trian- gular array of about half this size). With our current hardware, the largest array ... tional Linguistics. Christiane Fellbaum, editor. 1998. Word- Net: An Electronic Lexical Database. MIT Press. Marti A. Hearst. 1992. Automatic acquisi- tion of hyponyms from large text corpora. ... Thomas Ahlswede and Martha Evens. 1988. Parsing vs. text processing in the analysis of dictionary definitions. In Proceedings of the 29th Annual Meeting of the Associa- tion for Computational...
- 7
- 418
- 0
Báo cáo khoa học: "Creating a Multilingual Collocation Dictionary from Large Text Corpora" ppt
... col-location's keys occur on the same sentence, as theyare in a syntactical relation).When parallel corpora are available, also thetranslation equivalents of the collocation contextare ... Collocation Dictionary We used the collocations extracted from theFrench and English corpora for creating a database of knowledge that integrates collocations and in-stances of their actual use in language. ... encoding.133Creating a Multilingual Collocation Dictionary from Large Text Corpora Luka Nerima, Violeta Seretan, Eric WehrliLanguage Technology Laboratory (LATL), Dept. of LinguisticsUniversity of GenevaCH-1211...
- 4
- 353
- 0
Tài liệu The Anatomy of a Large-Scale Hypertextual Web Search Engine ppt
... created maps containing as many as 518 million of these hyperlinks, a significant sample of the total. These maps allow rapid calculation of a web page’s "PageRank", an Of course a distributed ... pages that point to it and have a high PageRank. Intuitively, pages that are wellcited from many places around the web are worth looking at. Also, pages that have perhaps only onecitation from ... type of full text searches in the main Google system, PageRank also helps a great deal. 2.1.1 Description of PageRank CalculationAcademic citation literature has been applied to the web, largely...
- 20
- 571
- 0
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf
... because of the absence of the catalyticsubunit ISP (Table 1). Figure 3A shows that a band of approximately 500 kDa was also found in this mutantstrain when the mitochondrial membranes were ana-lyzed ... was obtained from Amersham Biosciences(Chalfont St Giles, UK). All other reagents were of analytical grade.Yeast strains and growth mediaThe genotypes and sources of the S. cerevisiae strains ... coxidase complex was clearly demonstrated [10–12], butalso in other organisms, such as Neurospora crassa[13], mammals [11] and plants [14]. A higher-orderorganization of the respiratory chain...
- 15
- 639
- 0
Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx
... molecular basis of enzyme thermosta-bility. J Bacteriol 185, 4038–4049.20 Nanba H, Yajima K, Takano M, Yamada Y, IkenakaY & Takahashi S (1997) Process for producing d-N-car-bamoyl -a- amino acid. ... Bommarius AS, Schwarm M & Drauz K (1998) Biocatal-ysis to amino acid-based chiral pharmaceuticals - exam-ples and perspectives. J Mol Catal B-Enzym 5, 1–11.14 Liljeblad A & Kanerva LT ... molecular masswas also estimated by SDS–PAGE.Characterization and comparative analyses of HYDJsand HYDBpThe optimal temperature for activity of HYDJswith d-p-HPH as substrate was determined...
- 14
- 621
- 0
Tài liệu SCRIBE: The design of a large-scale event notification infrastructure? doc
... router-basedmulticast approaches and the lack of wide deployment of IP multicast limits their ap-plicability. As a result, application-level multicast is gaining popularity. Appropriatealgorithms ... Appropriatealgorithms and systems for scalable subscription management and scalable, reliablepropagation of events are still an active research area [8–11].Recent work on peer-to-peer overlay networks offers a ... 2001.15. S. Ratnasamy, P. Francis, M. Handley, R. Karp, and S. Shenker. A Scalable Content-Addressable Network. In Proc. of ACM SIGCOMM, August 2001.16. E. Zegura, K. Calvert, and S.Bhattacharjee....
- 13
- 631
- 0
Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf
... 5¢-GAGCCCGGATCCACCATGAAGGTCTCAATAATT 3¢;3¢ primer, 5¢-CTGACG GAATTCTTAAACATTAATGCC 3¢. These primers encoded a Kozak consensus sequence as well as BamHI and EcoRIrestriction sites. The PCR-amplified ... observed with M. brassicae CSPMbraA6[32]. We observed also that BrC15-Ac was able to displaceASA, suggesting that brominated fatty acid and ASA bothassociated with W81 in the same ligand binding ... innymphal regenerating legs of Periplaneta americana (Americancockroach). Int. J. Dev. Biol. 36, 391–398.29. Kitabayashi, A. N., Arai, T., Kubo, T. & Natori, S. (1998)Molecular cloning of cDNA...
- 11
- 642
- 0
Báo cáo khoa học: "Automatic Acquisition of Language Model based on Head-Dependent Relation between Words" pdf
... this paper, we presented a language model based on a kind of simple dependency gram- mar. The grammar consists of head-dependent relations between words and can be learned au- tomatically from ... create a language model from a large body of text. In the experiments, how- ever, DEP used the grammar acquired automat- ically as it is. In the grammar, many inter-word dependencies have ... J. Della Pietra, P. V. deSouza, J. C. Lai, and R. L. Mercer. 1992. "Class- Based n-gram Models of Natural Language". Computational Linguistics, 18(4):467-480. C. Chang and C. Chen....
- 5
- 334
- 0
- enhancing a large scale dictionary
- a large online dictionary
- acquisition of a lexicon
- a large subcategorization dictionary from corpora
- acquisition of dictionary resources
- automatic acquisition of named
- morphological analysis of a large spontaneous speech
- adjectival subcategorization frames from corpora
- the unsupervised acquisition of a lexicon from continuous speech
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25