authorised person means a person who is authorised for the purposes of the 2000 act
Báo cáo khoa học: A characteristic Glu17 residue of pig carnitine palmitoyltransferase 1 is responsible for the low Km for carnitine and the low sensitivity to malonyl-CoA inhibition of the enzyme docx
... used the construct pGEMT–5¢HumanCPT1B as a template in a PCR reaction with primers DH673 (5¢-AGCTGAATTC ATGGCGGAAGCTCACCAG-3¢) and DH803 (5¢-TCCA CCCATGGTAGCAGAGAAGCAGCTTAAGGGTTTGG CGGA-3¢) The ... The assay was performed at mm carnitine as standard To analyze PigE17DCPT1B and HumanD17ECPT1B mutants, the assay was performed at carnitine concentrations equal to the Km The percentage of activity ... concentrations of carnitine: mm (for standard comparison with other published data), and a concentration equal to the Km for carnitine of each enzyme (for comparison between mutants) In this article,...
- 9
- 550
- 0
Báo cáo Y học: Nuclear proteins that bind to metal response element a (MREa) in the Wilson disease gene promoter are Ku autoantigens and the Ku-80 subunit is necessary for basal transcription of the WD gene ppt
... proposed that the WD protein acts as a copperspecific pump that mediates the export of copper from the cytosol, similar to the P-type ATPase [14] On the basis of the fact that MREs mediate the transcriptional ... Taq (Takara, Japan) in a total volume of 50 lL containing 55 pg of competitor At this concentration, the band intensity of the amplified product from the competitor was same as that of the product ... normalized to b-gal activity, and the relative increases were calculated as the ratio of normalized activity in MREa/mutant transfected cells to that in pGLpro transfected cells Data represent the...
- 11
- 628
- 0
báo cáo hóa học:" A MIF haplotype is associated with the outcome of patients with severe sepsis: a case control study" pdf
... n .a n .a n .a Age is presented as mean and range of values (n .a. : not applicable) Page of (page number not for citation purposes) Journal of Translational Medicine 2009, 7:100 http://www.translational-medicine.com/content/7/1/100 ... 0.052 Data are presented as mean and range of values death due to severe sepsis compared to patients without allele CATT7 The concomitance of the -173 allele C and the -794 allele CATT7 as a haplotype ... After approval of the local ethics committee and written informed consent of the patient or a legal guardian had been obtained, 169 Caucasian patients with the diagnosis of severe sepsis according...
- 8
- 554
- 0
Báo cáo toán học: "The crossing number of a projective graph is quadratic in the face–width" doc
... preprocessing and then algorithm of Klein [9] (for planar distances) • Let F be the set of edges of G intersected by the (dual) edges of C ∗ Then G − F is actually a plane embedding, and we easily add the ... γ then define in this order the vertex set of a noncontractible dual cycle C ∗ , and so ≤ |V (C ∗ )| ≤ r∆/2 Proof of Theorem 1.2 The idea of the previous statement readily translates into an approximation ... constant factor ∆2 /(8cg ) of crg (G) Remark 4.2 In the planar case of Theorem 1.2, the described approximation algorithm yields a drawing of G within a factor 4.5∆2 of cr0 (G) References [1] D Bokal,...
- 8
- 336
- 0
báo cáo khoa học: " Peritoneal mesothelioma in a woman who has survived for seven years: a case report" pptx
... examination revealed abatement of the disease Indeed, the last laparotomy performed did not reveal any disease Second, the pathology report indicated that the patient had an epithelioid type of ... laparotomy during which division of adhesions and repair of a hernia was carried out No evidence of mesothelioma was found at this stage, and two months later, laparotomy was repeated for division ... differential diagnosis, the extent of the disease and the presence of invasion mitigated against this diagnosis The immunohistochemical (ICH) findings are shown in Table Two years later, the patient...
- 4
- 227
- 0
báo cáo khoa học: "Peritoneal mesothelioma in a woman who has survived for seven years: a case report" doc
... examination revealed abatement of the disease Indeed, the last laparotomy performed did not reveal any disease Second, the pathology report indicated that the patient had an epithelioid type of ... laparotomy during which division of adhesions and repair of a hernia was carried out No evidence of mesothelioma was found at this stage, and two months later, laparotomy was repeated for division ... differential diagnosis, the extent of the disease and the presence of invasion mitigated against this diagnosis The immunohistochemical (ICH) findings are shown in Table Two years later, the patient...
- 4
- 238
- 0
Báo cáo y học: " Induction of the HIV-1 Tat co-factor cyclin T1 during monocyte differentiation is required for the regulated expression of a large portion of cellular mRNAs" pptx
... β-actin (forward): AGCAAGCAGGAGTATGACGAGTC, β-actin: AGAAAGGGTGTAACGCAACTAAGTC (reverse), CSF1R(forward): TTCTGCTGCTCCTGCTGGTG, CSF1R(reverse): ACCGTTGCTCCTGGCTTCAC, LOX1(forward): ACTGTGAAGGACCAGCCTGATG, ... responsible for the pattern observed in the dendrogram, a two-way ANOVA was fit to each probeset using activation and knockdown state as explanatory variables A linear contrast analysis was then performed ... YW and XQ constructed and characterized the HIV-1 viruses and lentiviral vectors used in the study CS performed the analysis of DNA microarray data and performed the statistical analysis AR conceived...
- 16
- 178
- 0
Báo cáo y học: " PDZ domain-binding motif of human T-cell leukemia virus type 1 Tax oncoprotein is essential for the interleukin 2 independent growth induction of a T-cell line" ppsx
... found that Tax1 and Tax2 transform a rat fibroblast cell line (Rat-1) to induce colonies in soft agar (CFSA, colony formation in soft agar), and the activity of Tax1 is greater than that of Tax2 ... We also thank Sayoko Takizawa and Chika Yamamoto for the excellent technical assistance This work was supported in part by a Grant-in-Aid for Scientific Research on Priority Areas and a Grant-in-Aid ... the manuscript Acknowledgements We thank William W Hall for donating the Tax2B plasmid and the antibody against Tax2B We thank the Takeda pharmaceutical company for providing recombinant human...
- 7
- 177
- 0
EVALUATING a FINAL ENGLISH READING TEST FOR THE STUDENTS AT HANOI, TECHNICAL AND PROFESSIONAL SKILLS TRAINING SCHOOL – HANOI CON
... correct Standard deviation is the property of the normal curve Mathematically, it is the square root of the variance of a test Test analysis is the data from test trials are analyzed during the test ... selection of participants, the materials and the methods of data collection and analysis as well the results of the process of data analysis Part three: Conclusion – this part will be the summary to the ... has sometimes been regarded in the past as something additional and in no way an integral part of the syllabus or examination (p 15) 1.1.1.2 The structuralist approach “This approach is characterized...
- 60
- 718
- 1
Tài liệu Báo cáo Y học: The insert within the catalytic domain of tripeptidyl-peptidase II is important for the formation of the active complex potx
... as described in Materials and methods Enzyme activity was analysed by the standard assay and the immunoreactivity was detected by Western blot analysis and quantitated as described in Materials ... respectively The fragment originating from the rat gene is indicated by a hatched bar The activity in cell extracts of stable transformants was measured as described in Materials and methods The values ... indicated by asterisks to activate the material, as previously described [15] However, all attempts so far to associate this material have failed Thus, it appears that the isolated Arg252-containing...
- 6
- 520
- 0
Children''s Health and the Environment: WHO Training Package for the Health Sector World Health Organization potx
... the Earth’s atmosphere as measured at the top of Mount Mauna Loa on the Island of Hawaii Human activities are responsible for this dramatic rise This increase in greenhouse gases is causing an ... unsafe water is a major problem at all times To give an indication of the scale of health problems caused by lack of safe water, there are approximately billion cases of diarrhoea each year, causing ... 1994 for 18 Pacific Island countries There was a positive association between annual average temperature and the rate of diarrhea reports, and a negative association between water availability and...
- 66
- 705
- 0
UMTS Performance Measurement A Practical Guide to KPIs for the UTRAN Environment pdf
... means that the measurement values are related to a certain cell This is meaningful because several cells share the same Iub interface and in the case of softer handover they also share the same ... it is just a counter value, however, the gross margin is a KPI Hence, what makes the difference between performancerelated data and a KPI is the fact that a KPI is computed using a formula There ... analysis of huge data streams supplied by signalling information and user data/payload As a result the idea of a second book was already born before the first one was ready to be published Some major...
- 228
- 664
- 4
Báo cáo khoa học: N-Glycosylation is important for the correct intracellular localization of HFE and its ability to decrease cell surface transferrin binding pptx
... end of an a- helical region of the HFE a1 domain (V100 and W10 3A) as being of particular importance for TfR1 interactions [16,17,20] The effect of HFE binding to TfR1 is to lower the affinity of the ... nevertheless argue against the existence of a single glycosylation site that is of such absolute importance that it is capable in its own right of regulating localization, b2M interactions or transferrin ... N-Glycosylation of HFE TGGGCGTGATTTTCCAT To generate the pEP7–HFEN13 0A HA mutation we used the following primer set: sense, ATGCAAGAAGACGCCAGTACCGAGGGC; antisense, GCCCTCGGTACTGGCGTCTTCTTGCAT To generate...
- 16
- 538
- 0
Báo cáo khoa học: The N-terminal hybrid binding domain of RNase HI from Thermotoga maritima is important for substrate binding and Mg2+-dependent activity pot
... (5¢-cggagaugacgg-3¢), 29 base DNA13-RNA4(5¢-AATAGAGAAAAAGaaaaAAGATGGCAA DNA12 AG-3¢), 29 base DNA15-RNA1-DNA13 (5¢-AATAGAGAA AAAGAAaAAAGATGGCAAAG-3¢) and 3¢-FAM-labeled 18 base RNA9-DNA9 (5¢-uugcaugccTGCAGGTCG-3¢) ... TGGGTTTGAGAGCATATGAAGTTGG CAAAAAAATACTAC-3¢ for primer 1, 5¢- CGCATATG GAGACGATGATCGCCTACGTCGATG-3¢ for primer 2, 5¢-ACCGTTAAGCTTTCATAAACATCCTCCTTT-3¢ for primer 3, and 5¢- CGGAATTCTCATGTGTCCAGTTCTG GACAGATGCACTC-3¢ ... activity The binding affinity of Tma-W2 2A to the R29 ⁄ D29 substrate was analyzed in the absence of the metal cofactor using surface plasmon resonance and compared with that of Tma-RNase HI The KD value...
- 16
- 459
- 0
Báo cáo khoa học: YidC is required for the assembly of the MscL homopentameric pore potx
... were 5¢-AGCAGAATAA CTGCTCTCCTGGTG-3¢ (forward) and 5¢-CACCAGGAG AGCAGTTATTCTGCT-3¢ (reverse), and those for MscL F54C were 5¢-GGGATCGATTGCAAACAGTTTGC-3¢ (forward) and 5¢-GCAAACTGTTTGCAATCGATCCC-3¢ ... via the YidC insertase [6] Hence, it is likely that specific characteristics of the transmembrane pairs are also critical for the conditions of membrane insertion Analysis of the biogenesis of ... extraction of the IMVs to distinguish integral and peripheral membrane proteins T, total IMV sample; S, carbonate supernatant fraction; P, carbonate pellet fraction (B) As a control for the carbonate...
- 9
- 466
- 0
Báo cáo khoa học: "A Generalized-Zero-Preserving Method for Compact Encoding of Concept Lattices" pot
... calculate the optimal value of k, and the necessary length of the hashed array, to achieve any desired bound on the error rate In general, the hashed array can be much smaller than the original ... a constraint satisfaction problem like this one, we can ask two questions: is there a feasible solution, assigning values to the variables so all constraints are satisfied; and if so what is the ... successor of exactly one other element ULs are special because their set programming constraints always take a particular form: if x is a UL and a successor of y, then the constraints on its set Sx are...
- 10
- 410
- 0
Báo cáo khoa học: "A Cascaded Finite-State Parser for Syntactic Analysis of Swedish" potx
... the head of each phrase and the grammatical functions: TIME, SUBJ(ect) and P-0BJ(ect) Evaluation The performance of the parser partly depends on the output of the tagger and the rest of the preprocessing ... preprocessing software Our way of dealing with how "correct" the performance of the parser is, follows a practical, pragmatic approach, based on consultation of modern Swedish syntax literature We use the ... Clauses, Grammar3 a n d Grammar4: the clause resolution is based on surface criteria, outlined at the beginning of this chapter, and the rather fixed word order of Swedish Grammar3 distinguishes different...
- 4
- 288
- 0
CHILDREN AND FOOD SAFETY: WHO Training Package for the Health Sector doc
... thousands of deaths Salmonellosis is caused by the bacteria Salmonella Today, there are over 2500 known types, or serotypes, of Salmonella.Salmonellae are found in the intestinal tracts of animals ... Children and Food Safety PROTOZOA Toxoplasma gondii Giardia lamblia Entamoeba histolytica 16 Some protozoa that cause foodborne diseases are Toxoplasma gondii, Giardia lamblia, and Entamoeba histolytica ... soil; they can persist in soil for 10 years or more The eggs have a lipid layer, containing ascarocides and it makes them resistant to the effects of acids and alkalis as well as other unpleasant...
- 76
- 411
- 0
To amend the Public Health Service Act to provide for a Pancreatic Cancer Initiative, and for other purposes. ppt
... principal investigators 12 in pancreatic cancer, who are each an as- 13 sistant-level professor in a major academic 14 research institution and who have each re- 15 ceived at least grant from the National ... rector of the National Cancer Institute in ac- cordance with paragraph (5) regarding the prioritization and award of National Institutes of Health research grants relating to pancreatic 10 cancer ... 30 days after the establishment of the Committee, the Secretary shall publish the names of the Chair and members of the Com- mittee on the Website of the Department of Health and Human Services...
- 18
- 296
- 0
Báo cáo khoa học: Direct CIII–HflB interaction is responsible for the inhibition of the HflB (FtsH)-mediated proteolysis of Escherichia coli r32 by kCIII docx
... by the addition of mm EDTA and SDS ⁄ PAGE loading buffer, followed by heating in a boiling water-bath for The amount of r32 that remained after proteolysis was analyzed after SDS ⁄ PAGE of the ... Control of phage lambda development by stability and synthesis of cII protein: role of the viral cIII and host h A, himA and himD genes Cell 31, 565–573 Rattray A, Altuvia S, Mahajna G, Oppenheim AB ... partial inhibition was achieved As in the case of CII [10,11], CIII appears to work as an inhibitor for the proteolysis of r32 through direct interaction with the protease, characterized by a...
- 6
- 453
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25