at new belgium brewing greater efficiency is blowing in the wind
New Belgium Brewing Company: Brewing With a Conscience doc
Ngày tải lên :
18/03/2014, 00:20
... http://colorado.construction.com/COCN/CO-Oct02/COcover13Oct02.htm 22 New Belgium Brewing Company, Inc – website, http://www.newbelgium.com/frames.html New Belgium Brewing Company, Incorporated – “What in the Wind? ,” “NBB Steps to being Green,” and ... only does this eliminate CO2 emissions during fermentation, but the CO2 is also reused for purging tanks and carbonating beer later in the process The Alaskan Brewing Co had been spending about ... Brewery in Namibia was the brewery that the ZERI foundation constructed to produce beer using this model It was the only existing commercial brewery in the world in operation using this zero emissions...
- 26
- 288
- 0
Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle pdf
Ngày tải lên :
29/03/2014, 21:20
... M line, are involved in the transmission of mechanical signals to signaling pathways In the M line, mechanical stimulation activates the interaction of a protein complex with the kinase domain ... associated with a deregulation of the NF-jB pathway and an increase in muscle fiber apoptosis [8] The participation of NF-jB signaling in the pathogenesis of LGMD2A is therefore an interesting possibility ... promotes the binding to titin by improving the accessibility of the titin-binding domain Interestingly, the importance of CARP interaction for its function was recently demonstrated in a FEBS...
- 16
- 462
- 0
Citizen’s Basic Income: The Answer is Blowing in Wind
Ngày tải lên :
08/01/2017, 19:51
... till he knows that too many people have died? The answer my friend is blowing in the wind the answer is blowing in the wind What the poet means in this song is the answer is already there, ready ... sociologist Ana Lúcia Sabóia, to institute the Minimum Income Guarantee Program, through a negative income tax Following the debates in the PT surrounding the minimum income theme, I realized that the ... verified that the participation of these “other incomes” in the total of domicile income increased from 1.0% in 2003 to 1.6% in 2004 And what called attention is the extraordinary growth of the participation...
- 51
- 345
- 0
DSpace at VNU: A UVB-hypersensitive mutant in Arabidopsis thaliana is defective in the DNA damage response
Ngày tải lên :
16/12/2017, 04:08
... consistent with the possibility that the gene disrupted in suv2 is involved in the same pathway as AtATR for tolerance of replication inhibitors To investigate the possible roles of the gene disrupted ... revealed that this protein could be a substrate of ATR Thus, we named this gene AtATRIP Further detailed characterization of the AtATRIP protein could provide novel information of the checkpoint pathway ... suggesting that the AtATR gene is inactivated in this line First, we examined the responses of atr-5 and suv2-1 plants to HU When the suv2-1 seedlings were transplanted onto plates including 0.25...
- 9
- 96
- 0
Tài liệu The Benefits of Bank Deposit Rate Ceilings: New Evidence on Bank Rates and Risk in the 1920s (p. 2) docx
Ngày tải lên :
15/02/2014, 05:20
... may want all the regulatory tools they can get to maintain safety in a banking system that in many other ways is being deregulated Successful Attacks on Deposit Rate Ceilings In the 1960s, two ... subperiod The key question, then, is this: Can the variation in the passbook rate be explained by variation in the risk characteristics of banks? Before this question is addressed, however, another ... significant correlation between unregulated bank rates and bank risk, as modern finance theory predicts Now What? What does this new finding on banking in the 1920s mean for banking in the 1980s? Clearly,...
- 19
- 569
- 0
Tài liệu Báo cáo khoa học: A second novel dye-linked L-proline dehydrogenase complex is present in the hyperthermophilic archaeon Pyrococcus horikoshii OT-3 pptx
Ngày tải lên :
20/02/2014, 01:20
... analysis This means that ATG, which was situated bp downstream from the 5¢-terminus of the predicted ORF, is the proper initial codon for the a1 gene The N-terminal amino-acid sequence of the b1 ... No flavin compounds were bound to the a1 subunit of PDH1, though it did contain one ADPbinding motif This suggests the ADP-binding motif in the a1 subunit mediates the observed ATP binding, and ... As the a subunit exhibited dye-NADHDH activity, we supposed that one ADP-binding motif mediates FAD binding and the other is responsible for the dye-NADHDH 4049 FAD, FMN and ATP-containing amino-acid...
- 11
- 549
- 0
Tài liệu Báo cáo khoa học: "THERE STILL IS GOLD IN THE DATABASE MINE" potx
Ngày tải lên :
21/02/2014, 20:20
... database query, but this need not be the case The point of the spectrum is that there is a continuum from "database" to "knowledge base", and that the supposed limitations of one arise from the ... nuggets of theory are waiting to be discovered by enterprising computational linguists! I Speech input Interest in speech input to systems is undergoing a revival in both research and applications ... that the interpretive process of mapping from language concepts onto database concepts is sufficiently unlike the interpretation procedures for other uses of natural language that the db domain...
- 2
- 432
- 0
Processing Fluency and Aesthetic Pleasure: Is Beauty in the Perceiver''''s Processing Experience? pptx
Ngày tải lên :
16/03/2014, 18:20
... related rather than unrelated words, replicating the previous findings In contrast, attributing the affecfive response to the music did eliminate the effect of processing facilitation on liking ... hypothesis On the other hand, expectations entail an attribution to the variable that gave rise to the expectation in the first place When this variable is irrelevant to the evaluation of the ... response to the target, resulting in more positive evaluations This assumption is consistent with the feelings-as-information model, which holds that feelings serve as a source of information in their...
- 20
- 514
- 0
Báo cáo khoa học: Oxidative stress is involved in the permeabilization of the inner membrane of brain mitochondria exposed to hypoxia/reoxygenation and low micromolar Ca2+ Lorenz Schild1 and Georg Reiser2 doc
Ngày tải lên :
16/03/2014, 22:20
... medium at 30 °C and the fluorescence intensity (excitation at 488 nm, emission at 525 nm) was monitored (B) Rat brain mitochondria (0.5 mgỈmL)1) were incubated at 30 °C in incubation medium At the ... donors This is of relevance in brain, because in this tissue glucose is metabolized providing the NADH-yielding substrate pyruvate Under these conditions, some succinate is formed by the citric ... treatment The high degree of protection by ADP suggests that the mitochondrial injury is caused by opening of the mPTP There is evidence that ADP inhibits opening of the mPTP by occupying binding...
- 9
- 433
- 0
Báo cáo khoa học: An E3 ubiquitin ligase, Synoviolin, is involved in the degradation of immature nicastrin, and regulates the production of amyloid b-protein doc
Ngày tải lên :
23/03/2014, 04:20
... Synoviolin is involved in the degradation of nicastrin gene p53 [19] and Parkin-associated endothelin receptor-like receptor [20] In this study, we addressed whether Synoviolin is involved in the ... directly interacting with the substrate proteins and helping to transfer ubiquitin to them Therefore, to determine whether NCT is the substrate of Synoviolin, we determined whether Synoviolin interacts ... also suggesting that Synoviolin is involved in intracellular trafficking We also found that NCT interacts with Synoviolin (Fig 3), strongly suggesting that NCT is the substrate of Synoviolin As reported...
- 9
- 561
- 0
Báo cáo khoa học: Protein kinase Ch activity is involved in the 2,3,7,8tetrachlorodibenzo-p-dioxin-induced signal transduction pathway leading to apoptosis in L-MAT, a human lymphoblastic T-cell line potx
Ngày tải lên :
23/03/2014, 13:20
... using the human lymphoblastic T-cell line, L-MAT, as the model, that the AhR-mediated pathway is in no way involved in TCDD-induced apoptosis, [7,8] Furthermore, neither TCDD-mediated apoptosis ... PKCh) is involved in the TCDD-induced apoptosis of L-MAT cells The incubation of L-MAT cells with 20 nm TCDD resulted in morphological changes characteristic of apoptosis upon staining with the ... PKCh is translocated in TCDD-treated L-MAT cells We performed an nPKC translocation assay by fractionating L-MAT cells into cytosol and particulate fractions and then examining the translocation...
- 13
- 426
- 0
Hướng dẫn khắc phục lỗi “username is not in the sudoers file...” trong Ubuntu doc
Ngày tải lên :
30/03/2014, 00:20
... adding local content in /etc/sudoers.d/ instead of # directly modifying this file # # See the man page for details on how to write a sudoers file # Defaults env_reset # Host alias specification ... specification # User alias specification # Cmnd alias specification # User privilege specification root ALL=(ALL:ALL) ALL # Members of the admin group may gain root privileges %admin ALL=(ALL) ALL # Allow ... Finished Sau đó: - Tại giao diện dòng lệnh, gõ: sudo cp /etc/sudoers /etc/sudoers.backup sudo nano /etc/sudoers - Và nhập đoạn mã vào file hiển thị: # # This file MUST be edited with the 'visudo'...
- 4
- 860
- 1
Báo cáo khoa học: Myocyte enhancer factor 2B is involved in the inducible expression of NOX1⁄ NADPH oxidase, a vascular superoxide-producing enzyme ppt
Ngày tải lên :
30/03/2014, 03:20
... structure of the NOX1 gene and its splicing pathway Open boxes indicate exons Numbers in the box denote the size of each exon (bp) The size of the intron is indicated under the broken lines (bp) ... transcription initiation site (B) Introduction of mutations at the MEF2-binding site (5¢-CTATAAATAG-3¢ to 5¢-CTATAgccAG-3¢) abolished PGF2a-induced transcriptional activation A schematic diagram of the ... plasmids is shown on the left, where the 5¢ ⁄ 3¢ ends of the construct relative to the transcription initiation site are indicated The relative luciferase activity is denoted as the fold-increase induced...
- 9
- 452
- 0
Báo cáo khoa học: The GxxxG motif of the transmembrane domain of subunit e is involved in the dimerization/oligomerization of the yeast ATP synthase complex in the mitochondrial membrane doc
Ngày tải lên :
31/03/2014, 01:20
... Saccharomyces cerevisiae (P81449, Swiss-Prot) are in bold The numbering of the yeast subunit e begins at the initiating methionine The star indicates the position of the unique cysteine residue of the yeast ... 5¢-CGCGGAATTCTTAGTGATGGTGATG GTGATGTGTTGAAGCTTCCTTCAGGG-3¢ and 5¢-CAT CACCATCACCATCACTAAGAATTCCGCGATAGAA GCTTCAACATAAATAGGATACTA-3¢ were used to introduce the (His)6 sequence into the C-terminus ... were incubated in the absence or in the presence of CuCl2 (A) Digitonin extracts obtained with the indicated digitonin-to-protein ratios were submitted to BN/PAGE The gel was incubated with ATP-Mg2+...
- 10
- 550
- 0