at installation time mainly evaluating the improvement of the faces
thực trạng nhiễm hiv và các nhiễm trùng lây qua đường tình dục ở phụ nữ bán dâm 4 quận hà nội và hiệu quả một số biện pháp can thiệp bản tóm tắt tiếng anh
... was around 3-5% during the period of 20032011, but that of Ha Noi was 13-16% during the period of 2003-2005 The cumulative HIV number at the end of each year in this period of Thanh Xuan and Cau ... of FSW at the time of selection was larger than 10, the subject has been chosen randomly If the number was less than 10, all of the FSW at that time have been selected and the investigator had ... Institutional commitee in National Institute of Epidemiology and Hygiene at , date month .year Full disertation could be found at - National Library - The library of National Institute of Epidemiology...
- 28
- 919
- 0
Báo cáo y học: "Suicide attempts and related factors in patients admitted to a general hospital: a ten-year crosssectional study (1997-2007)" pot
... gender, educational level, cohabitation status, employment status, the psychiatric diagnosis at the moment of the interview, and the information on previous suicide attempts, we found that the variables ... Page of 10 of its expectation The parameters of the model are then estimated subsequent to the specification of the intracluster dependency correlation matrix In conclusion, our results show that ... in relation to the presence of the ideation of suicide and attempted suicide In relation with the differences found between men and women, the literature shows that a history of suicide attempt...
- 10
- 481
- 0
Real situation and Logistics applicability in freight forwarding of Haiphong Port – Recommendations to improve performance.doc
... delivering the goods in warehouse just in time, up date the information of the goods from the time out of stock to final destination of goods Thirdly, Haiphong port should coordinate with oversea ... effective application, maintenance and operation of the Quality Management system acclaimed the standards of ISO 9001- 2000 At the same time, the port continuously improves and upgrades the infrastructure ... price of goods at the port relatived to the price of goods inland Producers will not ship goods inland unless the prices they receive, net of shipping, is at least as high as prices at the port This...
- 30
- 741
- 5
Indoor Air Pollution Associated with Household Fuel Use in India: An exposure assessment and modeling exercise in rural districts of Andhra Pradesh, India doc
... indicates the likelihood of developing a disease among the exposed group relative to the unexposed A relative risk of indicates that the risk is the same in the exposed and unexposed groups; i.e there ... record time/ activity and other information at the household level to estimate the exposure of different household members The state of Andhra Pradesh (AP) in southern India was chosen as the study ... switching the location of the stove depending on the weather and their convenience The village residents were, however, able to relate to four categories of kitchen types selected in the study,...
- 114
- 415
- 0
correlation of depositors’ behavior and bank patronage in the inner districts of ha noi (3)
... of interest rates To prevent the over-increase of the cost of funds that would negatively impact the economy and economic activities, the State Bank of Viet Nam set the cap on deposit rates At ... United States Dollars (USD) is the official currency of the United States of America CHAPTER II REVIEW OF LITERATURE AND STUDIES The chapter presents the discussion of the overview of Viet Nam ... Noi? What are the profile of depositors in Ha Noi? What are the implications of depositors’ behavior? How are the depositors’ behavior and bank patronage correlated? What are the factors that influence...
- 162
- 235
- 0
situation of hiv, hbv, hcv infection and associated factors in some high risk populations in hanoi, 2008-2010
... Assoc Prof phD Nguyen Minh Son Thesis is protected at the assembly point of thesis at Level of Institute, meeting at the National Institute of Hygiene and Epidemiology, at last….now… dated… 2012 ... 10.9 7.4 0.30 3.4.6 Relations between marital status and the rate of HIV, HBV, HCV infection: Table 3.26 The relation between the rate of HIV infection and marital status of study subjects Sub ... HBV, HCV and history of hepatitis among study objects Table 3.32 The relation between the rate of HBV, HCV and history of hepatitis HBV infection HCV infection History of hepatitis n % n % Yes...
- 14
- 298
- 0
Actual situation study, some factors has risk to infect larva of toxocara canis in human and effect of treatment by albendazole at 2 commune of an nhon district, binh dinh province (2011 2012)
... dog the rate has been 13.1% The risk of the infection of Toxocara canis eggs in soil at households owning dog has been 4.7 times higher than that in households not owning dog The risk of the ... points, the common infection ratio of dog roundworm larvae at points is 43.0% There is no difference between the ratio of infected dogs and dog breeding at research points 3.3 TREATMENT EFFICIENCY OF ... life of larvae of Toxocara canis in environment A recovery rate of 69.8% has been showed by innovated floating method Rate of infection of larvae of Toxocara canis from ground was 8.7 % so that...
- 24
- 407
- 0
Efficiency Of Economic Linkage Between Enterprises And Farmers In The Southeast Region - The Current Situation And Affecting Factors
... contains the evaluation to the efficience of the cooperation between the interprises with the farmers; the second part is investigating the factors that affect the efficency of the cooperation and the ... evaluated the standart distribution will be analyzed by using SPSS and AMOS software to test the quality of the scale, the relevance of the model and study hypotheses of the relations between the ... which the nature of economic integration is the process of socialization of production Duong Ba Phuong (1995) Davis W Pearce (1999) said that economic integration is the situation where the different...
- 16
- 390
- 1
DEPRESSIVE SYMPTOMS AND RELATED FACTORS OF THE GENERAL MEDICAL STUDENT AT HAI PHONG UNIVERSITY OF MEDICINE AND PHARMACY IN 2016
... live in the hostels, the number of students1st grade are the highest percentage of 90,1%, followed by the 3rd and the 2nd grade Moreover, the living rate at the hostel of the 4th, the 5th, the 6th ... relates to suicide risk This risk is present throughout the course of the disease Therefore, the patients should be monitored closely Regarding the formation of the depressive episode, the situation ... 34%) In the study of Nieme, the depressive symptoms commonly see at the time of graduation than at start clinical (36% vs 17%) [30] The percentage of students showing depressive symptom of the grades...
- 78
- 403
- 0
Báo cáo y học: "Prevalence of Overactive Bladder, its Under-Diagnosis, and Risk Factors in a Male Urologic Veterans Population"
... for the general population Since OAB is a compilation of lower urinary tract symptoms, the prevalence of LUTS should be higher Irwin et al.2 in their 5-country population study reported the prevalence ... 2003; 20:327 Dallosso HM, Matthews RJ, McGrother CW, Donaldson MM, Shaw C and Leicestershire MRC The association of diet and other lifestyle factors with the onset of overactive bladder: a longitudinal ... analyses were performed using Stata 8.2 (StataCorp, College Station, TX) RESULTS Among the male patients, 1086 completed the questionnaire Table summarizes the demographic data Mean age was 68 years...
- 4
- 520
- 0
Tài liệu Báo cáo khoa học: Roles of AP-2 transcription factors in the regulation of cartilage and skeletal development doc
... differentiate into bone, followed by aggregation and the formation of mesenchymal condensation [48,49] These resting and proliferating chondrocytes produce an extracellular matrix mainly consisting of ... downregulated after treatment of the chick face with RA, and this is accompanied by an increase in apoptosis [73] The authors of this study ascribe the regulation of outgrowth of limb buds and patterning ... expression in the face and limbs In a follow-up study, they found that this conserved cis-acting sequence serves to maintain a level of AP-2a expression that limits the size of the hand plate and the associated...
- 9
- 642
- 0
Tài liệu Báo cáo khoa học: Moult cycle-related changes in biological activity of moult-inhibiting hormone (MIH) and crustacean hyperglycaemic hormone (CHH) in the crab, Carcinus maenas From target to transcript ppt
... than at any other time in the moult cycle As quantities of CHH were quite variable at different stages, ratios of CHH/MIH were calculated for pairs of sinus glands This analysis showed that the ... trend was that of moderate, statistically insignificant reduction in MIH content of the SG, relative to CHH, during late premoult Expression patterns of MIH and CHH in the X-organ during the moult ... with the resumption of competence of the YO at stage C1 Thus, it seems that selectivity, with regard to YO responses to MIH or CHH during the moult cycle is not at the receptor level In view of these...
- 9
- 587
- 0
Nutritional Status and Associated Factors in Institutionalized Elderly docx
... showed an imbalance in the ratio of fatty acids, with a predominance of saturated fat at the expense of monounsaturated and polyunsaturated fats, which may favor the occurrence of dyslipidemia and ... of data This subdivision allows the identification of homogeneous subgroups of individuals for the systematic comparison of their characteristics The division process is repeated until none of ... According to the CC classification, 59.4% of the seniors were at risk of complications associated with obesity and 70.3%, according to the WHR, were at risk of cardiovascular disease According to the...
- 5
- 552
- 0
Báo cáo khoa học: Delineation of the roles of FadD22, FadD26 and FadD29 in the biosynthesis of phthiocerol dimycocerosates and related compounds in Mycobacterium tuberculosis pptx
... GTTATGCCATAGCATCTAGGC fadD29I ACTTCGCAATGAAAACCAACTCGTCATTTC 2949H ACTTCGCAATGACCGAGTGTTTTCTATCTG 2949I ACAAAAGCTTTATTGGATGACCGCCCTAG res1 GCTCTAGAGCAACCGTCCGAAATATTATAAA res2 GCTCTAGATCTCATAAAAATGTATCCTAAATCAAATATC ... involved in the activation of the PpsA substrates during the formation of PGLs Among the fadD genes that belong to the DIM + PGL cluster, we identified a single candidate gene, fadD29, that may perform ... that FadD26 is required for the production of DIMs but not for that of PGLs This is the first demonstration that, although they have identical enzymatic properties in vitro, i.e the formation of...
- 11
- 550
- 0
The Fraction of Cancer Attributable to Lifestyle and Environmental Factors in the UK in 2010 docx
... cases of cancer in the UK (approximately 134 000 new cases in 2010), and about 50% of all cancer deaths Most of these cases of cancer (excluding a few thousand due to the natural background of ionising ... Over the past 40 years in the UK, the probability of death before the age of 70 years has been halved, and over the next few decades it could be halved again by continued improvements in the treatment ... about 25% of all deaths from cancer, plus similar numbers of deaths from other diseases) Taken together, the causative factors reviewed in this supplement account for an estimated 43% of all new...
- 92
- 563
- 0
Common factors in the performance of European corporate bonds – evidence before and after financial crisis pdf
... one-month risk-free rate of the previous month The proxy of the default risk is the difference between the return of corporate bonds and the return of maturity-matched government bonds The level and ... bonds and the one-month risk-free rate of the previous month The proxy of the default risk is the difference between the return of corporate 12 The Corporate Composite bond index and the Euro ... tested, K is the number of risk factors in the asset pricing model, µ is a column vector of mean returns of the risk factors, Ω is the unbiased estimate of the covariance matrix of the risk factors...
- 42
- 402
- 0
Báo cáo khoa học: Roles of prolactin-releasing peptide and RFamide related peptides in the control of stress and food intake potx
... and the anorectic effects of leptin are impaired in PrRP-deficient mice [13] These data suggest that the anorectic effects of leptin signaling are mediated, at least in part, by PrRP Role of PrRP ... intake Anatomical studies have shown that oxytocin neurons in the hypothalamus receive direct projections from PrRP neurons in the medulla oblongata The administration of PrRP activates neurons ... and oxytocin release into the systemic circulation Blockade of endogenous PrRP signaling by the administration of PrRP-neutralizing antibodies reduces the activation of hypothalamic paraventricular...
- 8
- 489
- 0
unsicker - cell signaling and growth factors in development
... neurons at the expense of other crest derivatives, some at ectopic cranial locations of the embryo that are usually devoid of neural derivatives of the neural crest At locations of normal sympathetic ... 793 The Role of BMP4 794 The Role of the Vasculature and VEGF Signaling 794 Postnatal Lung Development 795 The Influence of Peptide Growth Factor Signaling on the Correct Organization of the Matrix ... and then targeted for proteosome-mediated degradation In the presence of Wnt signaling, Dishevelled (Dsh) becomes activated, which leads to the uncoupling of b-catenin from the degradation pathway...
- 1,083
- 320
- 0
báo cáo sinh học:" Existing capacity to manage pharmaceuticals and related commodities in East Africa: an assessment with specific reference to antiretroviral therapy" ppt
... heads of the facilities providing ART services in the four countries were the key informants at the program level The survey looked at the types of HIV/AIDS services provided, the existence of guidelines ... higher at the time of the assessment A total of 54 facilities involved in ART services were surveyed in the four countries, comprising of 27 public, 18 private not-for-profit, private-for-profit, ... representatives of the AIDS Control Program from each of the four countries The workshop reviewed the data collection tools, discussed the assessment logistics and process and agreed on time lines Data...
- 5
- 376
- 0
báo cáo hóa học:" Determinants of Treatment Access in a Population-based Cohort of HIV-positive Men and Women Living in Argentina" pdf
... considerable number of people initiated therapy late in the course of HIV disease Further characterization of the population of HIV-positive individuals eligible for HAART in Argentina, in terms of co-infections ... It is therefore unlikely that this study had any of the selection biases that may be introduced when therapy is not free of charge Furthermore, the comprehensive geographic representation of our ... antiretroviral therapy in Argentina The proportion of patients with AIDS at enrollment suggests that a late HIV diagnosis appears to be common Page of (page number not for citation purposes) Journal of the...
- 7
- 398
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25