assign the time schedule to a partition that should be active only during the time specified in the time schedule
Báo cáo y học: "APOBEC3G induces a hypermutation gradient: purifying selection at multiple steps during HIV-1 replication results in levels of G-to-A mutations that are high in DNA, intermediate in cellular viral RNA, and low in virion RNA" pps
Ngày tải lên :
13/08/2014, 05:21
... Vif was amplified using the forward primer YRHHYmutF, 5'GGAAAGCTAAGGACTGGT TTGCTGCAGCTGCCGCTGAAAGTACTAATCCAAAAATA AG3', and the reverse primer VifR, 5'GGATAAACAGCAGT TGTTGC3' The resulting amplicons ... indicated that purifying selection pressure was operating against genomes that had inactivating mutations in the gag gene The observation that a few of the viral RNA-derived sequences had inactivating ... virus-containing supernatant were analyzed using the Quan-T-RT assay system (Amersham) The samples were then analyzed using the 1600 TR Liquid Scintillation Analyzer (Packard) To determine the RT activity...
- 15
- 320
- 0
PERFECT PRESENTATIONS Presenting with impact is a skill that can be learned by anyone
Ngày tải lên :
27/06/2016, 10:30
... present, not the laptop • Is about the message you want to convey Presentation • Like a glass containing good whisky • The glass contain the whisky so that people can appreciate and savour it • Allow ... throughout your career Presentation • • • • To get across the message, To inform, To explain, and To train • A powerful way – Presentation: An assumed skill • A skill managers expectd to have acquired ... interest and enthusiasm, • in a way that keeps the attention of your audience Presentation • Always about selling something • An idea • A different way of thinking Presentation tools Presentation tools...
- 23
- 393
- 0
Beyond Pinterest and Instagram Ten visual social networks that should be on your radarJuly 2012 pot
Ngày tải lên :
28/06/2014, 17:20
... any other user can add photos to that album EyeEm seems to be taking a similar approach to Tadaa in differentiating itself in being a higher end network for mobile photo enthusiasts Having said ... potential in Cinemagram Cinemagram allows you to create animated photos, or cinemagraphs - the Cinemagram blog gives examples, with many users having turned these animated gifs into an art form ... service has generated a lot of noise in the US in particular Brands have also started signing up, for example the Washington Post is using it for its Olympics coverage Rather than automatically funneling...
- 8
- 248
- 0
Interaction between a spoolable complliant guide and coiled tubing during subsea well intervention in deep water
Ngày tải lên :
16/10/2015, 15:35
... load transferred into axial force in the guide pipe can be estimated as maximum 1.3 times the load applied The local bending moment can be estimated as 0.81 times the load times the radial gap ... strain more accurately, as the strain at every reading point can be averaged twice as can be seen in equation (5.3) Consequently for phase and 4, 52 strain gauges have been attached onto the 25.4 ... declination angle quantifies the total change in angle along the pipe It was observed that the total declination angle was generally greater than twice the inclination angle Table 5-1: Test steps for each...
- 163
- 507
- 0
5 project management ideas that should be extinct
Ngày tải lên :
27/11/2015, 12:22
... There are many ways to manage a project: from Agile to Waterfall to hands-off supervision to management by walking around… And then there are these ideas that should go the way of the dinosaur ... https://www.flickr.com/photos/70321513@N00 The truth is there are better, more collaborative tools than email These tools allow efficient communication and better accountability — away from the inbox Click to learn about Wrike’s team ... meetings should involve only those whose work is directly affected by the agenda Send the agenda beforehand Use a timer to enforce a meeting’s length Click to Read: Tips for Better Meetings Photo...
- 14
- 142
- 0
Tài liệu Prelude To A Bull The Economic Signs That Signal Market(pdf) doc
Ngày tải lên :
17/01/2014, 03:20
... curve at the start of the year in January when it inverted for the first time in about ten years While many investors and analysts dismissed the inversion as related to technical factors such as ... and the economy First of all, the inversion was occurring because the bond market was beginning to believe that the Fed would have to raise rates aggressively to slow the economy That s exactly ... First and foremost it indicates that the markets expect the Fed to be friendlier toward the markets Indeed, the Fed has already turned friendly toward the markets having announced a surprise rate...
- 3
- 317
- 0
Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc
Ngày tải lên :
16/02/2014, 09:20
... domains: an a ⁄ b domain and an a domain (Fig 1A) The known activesite motif is found in a cavity between the two domains The a ⁄ b domain consists of a central six-stranded b sheet of mixed topology ... AppA, because there is a phenylalanine at the corresponding position The adjacent tyrosine in AppA points into the opposite direction from the helix In G1P of E coli a glutamine residue is at the ... substrate-free ˚ AppA the Ca atoms are 2.41 A apart, whereas for the substrate-free PhyK and the substrate-loaded AppA ˚ the averaged distance is only 1.87 A Distinct conformational changes were observed...
- 13
- 766
- 0
not just a living the complete guide to creating a business that gives you a life
Ngày tải lên :
01/06/2014, 10:25
... of the big draws is the chance to start a business that can turn a hobby into a pastime, an avocation into a vocation Robin Knepp spent nine years in the Marine Corps, rising to the rank of captain ... found that managing a fast-growing business was not his forte He was actually looking forward to being an employee again But after his wife took Imagining the Ideal Life a job requiring a two-hour ... Building as a college intern in the fact-checking department of People magazine For other people, that special place may be the beach, the mountains, a tropical isle, or a small town Places of the...
- 250
- 407
- 0
Báo cáo y học: "Standards of evidence in chronobiology: critical review of a report that restoration of Bmal1 expression in the dorsomedial hypothalamus is sufficient to restore circadian food anticipatory rhythms in Bmal1-/- mice" pot
Ngày tải lên :
10/08/2014, 09:20
... were clearly the same data, differing by ~3 h in the start -time, and in the placement of a red line intended to denote the onset of daily mealtime Notably, the two charts appear to be identical except ... pieces to eat A reasonable concern, therefore, is that any attenuation of food anticipatory rhythms in Bmal1-/- mice may be secondary to poor health due to inadequate food intake These concerns appear ... food intake data In their Reply [30] to the Technical Comment [15], the authors again provide no data, but state that the heterozygous and null mutant mice ate 85% of ad-libitum intake during the...
- 13
- 349
- 0
báo cáo khoa học: " Debunking the claim that abstinence is usually healthier for smokers than switching to a low-risk alternative, and other observations about anti-tobacco-harm-reduction arguments" potx
Ngày tải lên :
11/08/2014, 18:20
... by addressing the assertion that total social (population) risk will increase if THR is embraced, explaining how that is insupportable, before continuing to the new analysis of the individual ... choose to be abstinent In that case, THR offers a health benefit that is not going to be achieved by choosing abstinence, and thereby also provides a great welfare benefit Thus, either of these ... of tobacco [use]" [12] are tantamount to saying that any step that lowers the risk from using tobacco - whether it be creating a safer product or finding a cure for lung cancer - is unacceptable...
- 10
- 205
- 0
Báo cáo sinh học: "The complete linkage disequilibrium test: a test that points to causative mutations underlying quantitative traits" ppt
Ngày tải lên :
14/08/2014, 13:21
... suggested that the quest for the causative SNP had to be won on points rather than by knockout Their criteria for validating causality included linkage analysis and LD mapping, positional cloning, ... simulated assuming that the SNP detected by the QTL analysis is causative, with simulated QTL variances equal to the estimates obtained from the real data analysis, where every SNP i will in turn be assigned ... must be estimated from the real data The basic approach that is proposed is to perform a QTL analysis (i.e analysis I), and to calculate the TCLD statistic (TCLD(real)) Then, records are simulated...
- 8
- 414
- 0
The introduction of a system that would improve a manager’s ability to successfully supervise their employees, operating companies has been identified as a solution
Ngày tải lên :
17/01/2016, 19:35
... data from within the database A login system can also be created by using data in the database where the login details will be stored in the database and the system will validate the information ... comparing them with values that are stored in the database The data that will be entered into the online forms will be validated by the C# coding that is contained within the application The ... application all business rules has been saved on the database and database with application saved on the server The applications for accessing the database on the server should be used the stored...
- 31
- 448
- 0
Use the words in capitals to form a word that fits into the space next to it
Ngày tải lên :
29/08/2016, 18:07
... 26.We had to get special to leave early (PERMIT) 27.As the best man, he had to make a at the wedding (SPEAK 28 He was sitting in his seat on the train (COMFORT) ... There were only a of people at the match (HAND) 42 She arrived late at work because she had (SLEEP) 43 The road was too narrow, so they had to it (WIDE) 44 He was ... will be late (LIKELY) 38 I couldn't find any in his theory (WEAK) 39 He wants to be a when he grows up (MATHEMATICS) 40 You need to be a highly trained to understand...
- 3
- 652
- 1
The chart below shows the sleep patterns of people in five different occupations according to a Canadian study
Ngày tải lên :
04/10/2012, 10:02
... wake at a. m., but nap for two hours or so in the early afternoon Thus the influence on one's sleep pattern is worthy of consideration when choosing an occupation ...
- 2
- 1.4K
- 3
Requiem for a love that it had to die...
Ngày tải lên :
07/11/2012, 09:09
... to be remains Her will advances and the reserve of the past calms her down Then they go, or at least they think so They head to the ocean and they leave The love agony was never a bearable landscape ... Heading towards the horizon the tears look for the dryness that gives the oblivion, which hollows again that emptiness that allows new abundances, another one but that frightens the truth, the ... simultaneously not wanting to see it As a blind -in- one-eye person searching towards the absent side, livid furrowing the turbid and greasy surface, they turn outwards and then they return And then...
- 18
- 360
- 0
The vocabulary builder : The Practically Painless Way to a Larger Vocabulary
Ngày tải lên :
31/08/2013, 14:24
... Rabelais and was originally the name of a gigantic king who had a great capacity for food and drink The name was more recently given to an ape in an American film We use it today as an' adjective ... were happening (at one and the same time) The two parties have to the agreement (formally approve) If you water that plant, it may be (brought back to life) The art exhibit was a Chagall (all ... emotion? Add imilate to a donkey for a word meaning absorb Add ble to a young pigeon to get a noisy argument This word is both a pheasant-like game bird and a complaint Add irant to the snake that...
- 163
- 659
- 2
Tài liệu Create a Class That Implements the Interface You Defined docx
Ngày tải lên :
24/12/2013, 06:17
... below the class declaration to store class data, as shown in Listing 9.11 You should have one variable for each property As mentioned in Chapter 3, "Viewing Data with ADO.NET," prefacing class-level ... Enter at the end of each property and method declaration Doing so inserts the appropriate End tag When all the tags are in the class, Intellisense is reenabled 19 Add private variables directly below ... 2 Add a class declaration block to frmHowTo9_2 and name the class CCustomer After the line Public Class CCustomer, type Implements ICustomer This tells Visual Basic that the CCustomer class includes...
- 9
- 325
- 0
Use of an extension of the park's transformation to determine control laws applied to a non sinusoidal permanent magnet synchronous motor
Ngày tải lên :
03/01/2014, 19:50
... reduce to a two-phase system in the "a- p" kame For a non-sinusoidal machine can be not equal to zero, and then a zero-sequence current can be useful The Conmrdia's transfonnation has no more such interest, ... near of its minimal value -@I, and not supplied during the x 60" other interval of the electrical position [ 11 Only two phases are then supplied in the same time and the torque can be estimated ... electromotiveforces, the motor being not supply Park's transformation AAer this first transfoxmation, the Pa& transfomation allows us to work in the rotor's reference, through a rotation of an angle PO.Using the...
- 6
- 438
- 2