application example coin sorting using a robot
Báo cáo hóa học: " Results of Clinicians Using a Therapeutic Robotic System in an Inpatient Stroke Rehabilitation Unit" potx
... preferred a familiar Canadian measure, the CMSA This impairment measure divides arm and hand recovery into separate motor stages (1-7), allowing patients to be placed in similar bins as well as allowing ... 34 Abdullah HA, Tarry C, Datta R, Mittal GS, Abderrahim M: A Dynamic Biomechanical Model to Assess and Monitor Robot- Assisted Therapy of Upper Limb Impairment” Journal of Rehabilitation Research ... no.1 16 Erlandson RF: Application of robotic/mechatronic systems in special education, rehabilitation therapy, and vocational training: A paradigm shift” IEEE Transactions on Rehabilitation Engineering...
- 12
- 368
- 0
Label free and reagentless electrochemical detection of microRNAs using a conducting polymer nanostructured by carbon nanotubes application to prostate cancer biomarker mir 141
... NH2–CCATCTTTACCAGACAGTGTTA 3′ 3′ GGUAGAAAUGGUCUGUCACAAU 5′ 3′ UUGUGACUAAAGUUUACCACGAU 5′ 3′AGUAUC GGGACAUGUUACGACGA 5′ 166 H.V Tran et al / Biosensors and Bioelectronics 49 (2013) 164–169 2.5 Grafting ... Lusi, E .A. , Passamano, M., Guarascio, P., Scarpa, A. , Schiavo, L., 2009 Analytical Chemistry 81, 2819–2822 Mitchell, P.S., Parkin, R.K., Kroh, E.M., Fritz, B.R., Wyman, S.K., Pogosova-Agadjanyan, ... Biosensors and Bioelectronics 22, 3126–3131 Planell-Saguer, M., Rodicio, M.C., 2011 Analytica Chimica Acta 699, 134–152 Qavi, A. J., Kindt, J.T., Bailey, R.C., 2010 Analytical and Bioanalytical Chemistry...
- 6
- 298
- 0
Báo cáo y học: "Endoscopic Carpal Tunnel Release using a modified application technique of local anesthesia: safety and effectiveness." potx
... prilocain subcutaneous at the volar side of the hand was done Figure quet value and standard deviation Scale (0–10) Meanpain with the Visual Analogue of injection and tourniMean value and standard ... distal wrist down to the palm and should not penetrate the ligamentum carpi transversum At this stage the application of 10 ml LA was made One patient required additionally local anesthesia because ... Wood SH, Logan AM: A local anaesthetic technique for endoscopic carpal tunnel release J Hand Surg [Br] 1999, 24(3):298-9 Patil S, Ramakrishnan M, Stothard J: Local anaesthesia for carpal tunnel...
- 4
- 414
- 0
A general framework for robot programming using a matrix based supervisory controller
... matrix used in the matrix model are logical equations, standard matrix multiplication and addition are replaced by AND/OR algebra and all vectors and matrices are binary ⊗ represents a logical ... that controlling a robot and changing a behaviour is solely based on the manipulation of a set of matrices A favoured feature of the matrix-based approach is that of a validity check on the task ... a ’Teaching by demonstration’ (also known as Programming by Demonstration) method to generate a robot program that allows a robot to carry out a task as demonstrated by a human The generated...
- 269
- 204
- 0
Vector sum phase shifter using a quadrature magic t for application in polarization control
... a linearly polarized horn antenna, Fig 1-2 shows a dual linear polarization horn antenna, Fig 1-3 shows a circularly polarized spiral antenna, and Fig 1-4 shows a dual linearly polarized array, ... polarization spiral antenna Fig 1-4: Dual linear polarization array taken from [7] It is important to note that the dual linear polarization antenna can also be converted into a circular polarized ... communication or radar is transmitted through an antenna The polarization of the EM wave is dependent on the polarization of the antenna Antenna polarization is a characteristic of the antenna and...
- 144
- 238
- 0
Báo cáo y học: "Prevention of Pleural Adhesions Using a Membrane Containing Polyethylene Glycol "
... Figure Macroscopic images of the rats A: Appearance of the visceral pleura after abrasion with dry and iodinated spanch B: Placement of a x cm anti-adhesion membrane (Prevadh®) in the adhesion ... thoracotomy by using a hyaluronate-based absorbable membran in rats [6] Also, Getman et al achieved the same effect by using haemostatic membrane [7] The present study investigates the efficacy ... findings are also based on the result of macroscopic and histopathological examinations However, biochemical data would elucidate physiopathological changes associated with pleural adhesion and the...
- 7
- 453
- 0
Natural botanical products have a long history in the world and are featured in using a complex
... intratumoral injection of "Star-99" in treatment of hepatocellular carcinoma of nude mice World J Gastroenterol 2003, 9: 701-5 Nandakumar KS, Lakshmi Rao K, Pardhasaradhi BV, Khar A Upregulation of antitumor ... Yasukawa K, Ikeya Y, Mitsuhashi H, Iwasaki M, Aburada M, Nakagawa S, Takeuchi M, Takido M Gomisin A inhibits tumor promotion by 12-O-tetradecanoylphorbol-13acetate in two-stage carcinogenesis in ... treatment groups was analyzed using a two-way statistical analysis of variance (ANOVA), followed by Dunnett t-test and post-hoc analysis when necessary Results Effect of CKBM treatment on gastric tumor...
- 9
- 712
- 0
Báo cáo y học: "Discriminating between elderly and young using a fractal dimension analysis of centre of pressure"
... from a fractal pattern may be indicative of a shift towards an unhealthy or less desirable control strategy The analysis of fractal patterns in gait and posture data may serve as an indicator ... Parkinsonian patients (PP), spinocerebellar ataxia (SCA) patients, and healthy participants’ COP were analysed using a more traditional fractal dimension analysis [13] This method recorded COP data and ... of appropriate non-linear analysis, such as fractal analysis, in place of traditional analyses [1] A strong reason behind this paradigm shift is the acknowledgment of variability in natural systems...
- 10
- 457
- 0
Estimation of Proper Strain Rate in the CRSC Test Using a Artificial Neural Networks
... the field data In particular, these differences are increase at the high strain rate range The reason is that ANN model has not a lot of database on the high strain rate To eliminate this effect ... realize complex mapping In order to verify the applicability of MANN model, a total of 46 data of the consolidation test results are used 43 learning data are used for training the ANN model, and ... OF STRAIN RATE r= V − Vmin Vmax − Vmin Data Collection Data Normalization Parametric Studies (3) Training and Testing ANN in which LI is the liquidity index with soil saturated, Pa is the atmospheric...
- 5
- 516
- 1
STRATEGIC PLANNING FOR PROJECT MANAGEMENT USING a PROJECT MANAGEMENT
... 9:42 AM Page 5 Gap Analysis fected by the organization’s performance, but may even have a claim on its performance As an example, unions can have a strong influence on how a project management ... critical success factors: qualitative factors, organizational factors, and quantitative factors To take advantage of the economic outlook, whatever it happened to be at a given time, senior managers ... Responsibility Evaluation of Information Managerial Values of Management Strategy Evaluation Strategy Selection Strategy Implementation FIGURE 2–1 Basic strategic planning Corporate Strategic Plan Strategic...
- 271
- 629
- 2
Research on MAP Recovery Conditions using a Fluidized-bed Crystallized Phosphorous Removal System
... phosphorus load (kg-P/d), VMAP is Volume of MAP particle layer (m3), SMAP is Overall MAP surface of MAP particle layer (m2) Overall MAP surface was calculated using the following assumption a) MAP particles ... apparatus was made by adding magnesium and adjusting the pH, and new MAP was made to form on the surface of the MAP particles already in the reactor The interior of the reactor was aerated using air ... mm), and a treated water tank Raw water NaOH Treated water The raw water and part of the treated water in the treated water tank was made to flow upward Treated water tank (LV: 60 m/hr) from the...
- 6
- 438
- 0
A biodegradation and treatment of palm oil mill effluent (POME) using a hybrid up-flow anaerobic sludge bed (HUASB) reactor
... Rajakumar, R and Meenambal, T [3] to investigate the performance for each hybrid UASB reactor and anaerobic filter (AF) reactor, where the comparison of this study was mainly compared the start-up ... to be transferred to the analysis laboratory for parameters analysis The related parameters were observed and analyzed daily are Chemical Oxygen Demand (COD), Total Nitrogen (TN), Total Phosphorus ... Habeeb, S A. , AB Aziz Bin Abdul Latiff., Zawawi Bin Daud., Zulkifli Bin Ahmad A review on granules initiation and development inside UASB Reactor and the main factors affecting granules formation process...
- 8
- 408
- 0
Estimation of emissions of nonmethane organic compounds from a closed landfill site using a landfill gas emission model
... show the minimum and maximum annual average acceptance rates to be 999.2 mg/year and 1000.8 mg/year respectively The mean, variance, and standard deviation are 1000 mg/year, 0.0504, and 0.225 respectively ... generation rate, k and potential methane generation capacity, Lo Emission type Landfill type CAA Conventional CAA Arid area Inventory Conventional Inventory Arid area Inventory Wet (bioreactor) Source: ... dioxide are the major gases produced by biodegradation of landfill wastes [2-4, 7] According to Scheutz et al [2], the biodegradable organic material in waste includes paper, animal and vegetable matter,...
- 8
- 540
- 0
Optimal placement of horizontal - and vertical - axis wind turbines in a wind farm for maximum power generation using a genetic algorithm
... pp.927-938 935 (a) Best, mean and median objective valuses for Case I (b) Standard deviations for Case I (c) Best, mean and median objective values for Case II (d) Standard deviations for Case II Figure ... Table Case III has been taken from the paper of Yan et al [12] and Case III has a double rotor radius compared to Case IV so that the tip-speed ratio also doubles Again, the size of the farm is ... William Palm Professor of Engineering in department of Mechanical Engineering and Materials Science at Washington University in St Louis, MO, USA He is a Fellow of ASME, AIAA, IEEE, and SAE E-mail...
- 12
- 635
- 1
Measuring Word Recognition Using a Picture
... "Look at the picture (Pause) Look at the words around the picture (Pause.) Find the biggest word What is that word? (Students will say, "Table.") A line has been drawn from that word to the TABLE ... specifications above utilize the format that appears in Lynch and Davidson (1994), "Criterion-referenced language test development: Linking curricular, teachers, and tests." TESOL Quarterly 28(4), ... one example word that is familiar to all students and is bigger than the rest of the words Difficulty of Items The task will contain words of varying degrees of difficulty, ranging from very easy...
- 3
- 322
- 1
Tài liệu tiếng anh Điện tử công suất mạch MERS Voltage rating reduction of magnetic power supplies using a magnetic energy recovery switch
... large scale magnets which have large time constant are suitable applications However quite large scale applications which have huge magnetic energy is not suitable because these applications not ... parts of energy pulsate and cause voltage fluctuations of the capacitors The capacitors must maintain the voltage within a range; therefore the capacitors must store energy as large as several ... current was controlled fast by that voltage time constant of the laboratory scale circuit is much shorter than that of real applications In the first experiment, target condition was set to A with...
- 4
- 535
- 0
Anatoy of a Robot
... that making the actuator gain as large as possible is desireable Just be aware that increasing the gain of the actuator adds expense and will adversely affect the dynamic (nonsteady state) behavior ... mechanism for refilling the tank with the appropriate amount of water, and reliability is paramount The average toaster is great at browning bread in a repeatable manner You can probably walk ... chapter outlines a coordinated approach to the selection of a processor, a battery, a power supply, operating software, and application software Included are many software techniques that have...
- 321
- 216
- 0
Using a DataGrid Control to Access a Database
... Preview dialog box Next, you need to create a DataSet object You use a DataSet object to a store local copy of the information stored in the database A DataSet object can represent database structures ... your database administrator) Drill down to the Customers table in the Northwind database and drag it to your form This creates a SqlConnection object named sqlConnection1 and a SqlDataAdapter ... contains DataSet1, as shown in Figure 6.15 Figure 6.15: Entering the DataSet details in the Generate Dataset dialog box Click the OK button to continue This adds a new DataSet object named dataSet11...
- 8
- 486
- 0
Using a DataReader Object in Visual Studio .NET
... System.Data.SqlClient.SqlDataReader mySqlDataReader = sqlCommand1.ExecuteReader(); while (mySqlDataReader.Read()) { listView1.Items.Add(mySqlDataReader["CustomerID"].ToString()); listView1.Items.Add(mySqlDataReader["CompanyName"].ToString()); ... SqlDataReader object to a string Also notice you include the namespace when referencing the SqlDataReader class: you use System.Data.SqlClient SqlDataReader when creating the SqlDataReader object ... listView1.Items.Add(mySqlDataReader["CompanyName"].ToString()); listView1.Items.Add(mySqlDataReader["ContactName"].ToString()); } mySqlDataReader.Close(); sqlConnection1.Close(); } Notice you add an item to the ListView control using...
- 4
- 535
- 0
Using a SqlConnection Object to Connect to a SQL Server Database phần 1
... Server database */ using System; using System.Data; using System.Data.SqlClient; class MySqlConnection { public static void Main() { // formulate a string containing the details of the // database ... ADO.NET automatically stores database connections in a pool Connection pooling offers a great performance improvement because you don't have to wait for a brand new connection to the database to ... to be established when there's a suitable connection already available When you close a connection, that connection isn't actually closed; instead, your connection is marked as unused and stored...
- 7
- 729
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25