antibodies t cell receptors andt cell vaccines
Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt
... primer, 5¢-GGGTAATTTGAGATC TTTATATGATAACC-3¢ and 3¢ primer, 5¢-CGCGCGG GATCCTTAGTGATGGTGATGGTGATGGGTGACC GGTTTTTTGGTAGGTGAAC-3¢ The third PCR was carried out using PCR products, the first PCR 5¢ primer ... 5¢-CGCGCGGGATCCTTAGTG ATGGTGATGGTGATGGGTGACCGGTTTTTTGG Ó FEBS 2004 Interaction of human TCR with superantigen SSA (Eur J Biochem 271) 4077 TAAGGTGAAC-3¢) that had NcoI and BamHI restriction sites, respectively ... poisoning to generate protective antibodies without systemic effects [16,17] Streptococcal superantigen (SSA) is a 260 residue protein produced by S pyogenes that can generate symptoms similar to TSS...
- 9
- 485
- 0
Báo cáo hóa học: "Programmed cell death-1 (PD-1) at the heart of heterologous prime-boost vaccines and regulation of CD8+ T cell immunity" doc
... deleterious anti-vector immunity The priming strategy could then be matched with heterologous vectors that expand and/ or differentiate the primed cells to therapeutically useful effector T cells ... antigen exposure and other factors •Limited antigen exposure, with potent co-stimulation could lead to T cells that retain low PD-1 expression through various stages: recently activated, effector ... [42]) This tandem co-regulation of inhibitory receptors [45-47] raised the possibility that this phenomenon, consisting of the generation of specific T cells that fail to up-regulate PD-1, extends...
- 11
- 505
- 0
Báo cáo y học: "Differential clinical efficacy of anti-CD4 monoclonal antibodies in rat adjuvant arthritis is paralleled by differential influence on κ α NF-κB binding activity and TNF-α secretion of T cell" pot
... subpopulation of regulatory T cells, an Arthritis Research Vol No Pohlers et al interpretation that is supported by: i) the increase of T- cell reactivity in some patients successfully treated with antiCD4 ... respectively), showed that the therapeutic anti-CD4 mAb was present on the cells as long as days after the last injection of the mAb After treatment with W3/25, the percentage of CD8+ cells did not ... proliferation rates than those from W3/25- or OX35-treated rats (Supplementary Fig 2) In the mixed lymphocyte culture, RIB5/2 was also the most potent inhibitor of T- cell activation in the case of total...
- 14
- 431
- 0
Báo cáo y học: "Insights into spatial configuration of a galactosylated epitope required to trigger arthritogenic T-cell receptors specific for the sugar moiety" ppsx
... at that position were barely recognized by the T cells It is plausible that the primary amine at ε position participates in electrostatic interactions with negatively charged residues of the TCR ... encephalomyelitis [27] revealed that there were few specific contacts between the TCR CDR3 loops and the cognate peptide Competing interests The authors declare that they have no competing interests the ... interests the collaboration of the staff of the Central Cytometry Laboratory in the Cochin Institute This work was supported by institutional grants from Institut National de la Santé et de la Recherche...
- 9
- 318
- 0
báo cáo khoa học: " Effect of Chemokine Receptors CCR7 on Disseminated Behavior of Human T cell Lymphoma: clinical and experimental study" pps
... 5’-TCCTTCTCATCAGCAAGCTGTC-3’ and reverse 5’-GAGGCAGCCCAGGTCCTTGAA-3’ (529 bp fragment); PI3K, forward 5’-CATCACTTCC TCCTGCTCTAT-3’ and reverse 5’-CAGTTGTTGGCAATCTTCTTC-3’ (377 bp fragment); Akt, forward ... individually Statistical Analysis Data were analyzed with SPSS 11.5 software Statistics processing about clinical data were evaluated with c2 test, Spearman’s rank correlation test Statistics processing ... influenced tumor cell migration in vitro and the metastatic Figure The expression of PI3K mRNA in Jurkat and Hut cells after CCL21 co-culture in vitro RT-PCR amplication of the two cell lines under the...
- 9
- 410
- 0
The characterization of soluble t cell receptors specific for the parasite toxoplasma gondii
... affinities of the three TCR clones with the effector function of the T cells expressing them I observed that the binding affinities of the TCR not correlate positively with the strength of their ... counterparts If they were to be used as potential therapeutics, their stabilities would be important as it would directly impact on their abilities to reach the target site of interest, maintain ... specific T cells in adoptive T cell transfer whilst the other would be utilizing soluble T cell receptors as therapeutic tools Adoptive T cell transfer has seen much success in the treatment of cancer...
- 164
- 367
- 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx
... AGTGAGATGGATACAGGTGCTAAAC TCTGGACCTCAGACATGAACTTACT TGTCAGTCCTCTTTAATGCT AATGGTATCCTGTTTGGCTCAG GGTTGTAATTGTACACGGTAGTC CGGTAGTCAGGAAATCAATGCC CCATGTCTGCAGATGGTCGAGG GGACTGACATTGCTCCAGAGC GCTTCAGTGACTCAGAAATTGG ... TGAGTTACACGTTCAGTCAGCAATATG Real-time TCTTGGTCTTTAGTTCTTATCATCTTGAGC Real-time AAGATTCTCAGCTACATAATGCACACC Real-time ATGCTCATCAGTAGATTCTGCTCAC Real-time ACGCTTCTTCTTTGCGACTG Real-time CACCATATCCCGCTTGAGTT Real-time ... GCTTCAGTGACTCAGAAATTGG GTCCAGAATATTCAGCCTTTCACC CTCCCTCAAACAAACCAGAGTC CACTGGATGAGACAGGAAGTT CTTCTCCAGGACAGTCCAAAGAGTC CTGGATTGAAGCGCCCTCGGTTAATC GCTGCCTTTGTTATTTGTAAGCTTCAG GGAAACTTCCTGTCTCATCCAGTG...
- 20
- 689
- 0
Tài liệu Báo cáo khoa học: Design, structure and biological activity of b-turn peptides of CD2 protein for inhibition of T-cell adhesion ppt
... different concentrations studied These peptides were also tested for their toxicity using the MTT assay [17] All the four peptides tested in the study resulted in 90–100% viability indicating that these ... primary structure of the peptide To confirm our hypothesis that the b-turn structures are important for the inhibitory activities of the peptides, the structures of the cyclic peptides were determined ... indicated that the cyclic peptides acquire b-turn structures in solution Cell viability assays clearly suggested that the peptides are not toxic to cells tested in the studies, and represent potential...
- 14
- 657
- 0
Tài liệu Báo cáo khoa học: Separation of a cholesterol-enriched microdomain involved in T-cell signal transduction doc
... indicates that total raft fractions contain two distinctly different subpopulations of membranes with respect to cholesterol enrichment Approximately 40% of total raft protein was recovered in the ... contents recovered in raft fractions depend on detergent concentrations We examined the effect of Triton 5457 Two raft subsets in T- cells Fig Protein partitioning under different detergent conditions ... fraction contained cholesterol at a level more than twofold that of the unbound fraction, a finding consistent with its higher C ⁄ P ratio It is noteworthy that the PS ⁄ PI intensity ratio was remarkably...
- 10
- 588
- 0
Báo cáo khoa học: SHP-1 dephosphorylates 3BP2 and potentially downregulates 3BP2-mediated T cell antigen receptor signaling ppt
... anti-CD3 stimulation in 3BP2-transfected cells Furthermore, SHP-1 also inhibited the constitutive NFAT activation in 3BP2-transfected cells but not the basal NFAT activity in the cells without ... response to TCR activation We next determined the effects of these 3BP2 mutants on NFAT activation To so, we cotransfected 3BP2 or its mutants with NFAT-luciferase (firefly) reporter into Jurkat cells ... dephospharylate 3BP2 without association of the two proteins through the SH2 domain–phosphotyrosine interaction in the condition with the overexpression of the two proteins To exclude the possibility that...
- 11
- 341
- 0
Báo cáo khoa học: Investigation of the kinetics and order of tyrosine phosphorylation in the T-cell receptor f chain by the protein tyrosine kinase Lck potx
... peptide was incubated without the GST-Lck To determine the total radioactivity present for each experiment, 12 lL lots of pooled, stopped reaction mixture were pipetted on to three phosphocellulose ... Consequently, tyrosines located on the peptides may be expected to exhibit the same kinetics as those located on the intact protein Therefore, determination of the kinetics of phosphorylation of these ... occur at a constant rate over the 30 duration of the assay (data not shown) and was not limited by concentrations of peptide or ATP, the latter giving rise to near saturation (95%) of the enzyme...
- 8
- 570
- 0
Báo cáo khoa học: Oligomannose-coated liposomes efficiently induce human T-cell leukemia virus-1-specific cytotoxic T lymphocytes without adjuvant doc
... relapse of ATL in postallogeneic stem cell transplantation patients The expression of Tax by the host cell targets them for attack by CTL, resulting in the elimination of the infected cell [32] ... stem cell transplantation patients, which might account for the efficacy of this therapy [31] Therefore, the efficient induction of HTLV-1-specific CTL by OML ⁄ Tax could be adapted to prevent the ... cultured PBMCs The numbers in the upper right quadrants represent the percentages of tetramer+CD8+ T cells in T lymphocytes (B) Cytotoxic activity of induced HTLV-1-specific CD8+ T cells Using HTLV-1...
- 9
- 243
- 0
Báo cáo khoa học: Intrabodies against the EVH1 domain of Wiskott–Aldrich syndrome protein inhibit T cell receptor signaling in transgenic mice T cells potx
... 5¢-CACCCAAGCTT GCCACCATGGAGGTTCAGCTGCAGCAGTCTG-3¢; primer 7, 5¢-GGT GGAGGAGGTTCTGATGTTTTGATGACCCAAACTCCAC-3¢; primer 8, 5¢-CGAATGCGGCCGCCCGTTTGATTTCCAGCTTGGTGC-3¢; primer 9, 5¢-GGTGGAGGAGGTTCTGATGTTGTTCTGACCCAAACTCCACTC-3¢; ... CCTCCTCACCGGATCCTCCACCTCCAGAACCACCACCCCC-3¢; primer 13, 5¢-CGTCTCCTCAGGGGGTGGTGGTTCTGGAGGTGGAG GATCCGGTGGAGGAGGTTCT-3¢; primer 14, 5¢-CGTCTCCTCA GGGGGTGGTGGTTCTGGAGGTGGAGGATCCGGTGGAGGAGG TTCT-3¢ In all ... study the majority of scFvs were detected in the cytosolic fraction (Fig 7A), and not in the T- cell culture supernatant (data not shown) These results indicate that the scFvs constructed with...
- 14
- 493
- 0
Báo cáo Y học: GPI-microdomains (membrane rafts) and signaling of the multi-chain interleukin-2 receptor in human lymphoma/leukemia T cell lines doc
... These antibodies detect nonphosphorylated and phosphorylated Tyr moieties on STAT3/STAT5, respectively, without appreciable cross-reaction with other Tyr-phosphorylated STATs After washing, cells ... proportional to binding of anti-(phospho-tyr-STAT3) Ig or anti-(phospho-tyr-STAT5) Ig in unstimulated cells, while white bars indicate its binding 15 after IL-2 stimulation Cell treatments are indicated ... obtained from cells pretreated with mM MbCD Aliquots were taken from the samples at the indicated times after IL-2 addition After subjecting these aliquots to lysis, SDS PAGE and Western blotting,...
- 10
- 499
- 0
T-CELL LEUKEMIA CHARACTERISTICS, TREATMENT AND PREVENTION potx
... density on the malignant T- cells Most antibodies deliver their therapeutic effect by binding to the target on the cell surface, activating complement, antibody dependent cellular cytotoxicity (ADCC) ... and its stimulation results in T- cell activation and antigen co-stimulation It also potentiates the physical interaction between T- cells and antigen presenting cells, as well as between T- cells ... other T- cells or hematopoietic cells, treatment will not only eliminate the tumor cells, it will also cause depletion of functional T- cells allowing reactivation or susceptibility to a variety...
- 148
- 635
- 0
Báo cáo khoa học: Protein kinase Ch activity is involved in the 2,3,7,8tetrachlorodibenzo-p-dioxin-induced signal transduction pathway leading to apoptosis in L-MAT, a human lymphoblastic T-cell line potx
... Moreover, we found that PKCh, but not PKCd, was activated in TCDD-treated L-MAT cells We suggest that TCDD treatment of L-MAT cells induces signal transduction, leading to very rapid activation of PKCh, ... indicated in the text), were fractionated Then, 40 lg of the particulate (membrane + cytoskeleton) fraction protein was examined by Western blotting to determine whether TCDD treatment caused translocation ... from the nontransfected cells in the miniMACS column and then tested for caspase-3 activation by treatment with TCDD In this experiment, TCDD-induced caspase-3 activation (that is, apoptosis)...
- 13
- 426
- 0
Báo cáo khoa học: Tec family kinases Itk and Rlk⁄ Txk in T lymphocytes: cross-regulation of cytokine production and T-cell fates pot
... T- cell differentiation, it will be of interest to see the role of the TFKs in regulating the differentiation of this subset Together, these studies suggest that the TFKs, particularly Itk, but ... expressed by the differentiation of CD4+ T cells into distinct effector T cells These subsets include Th1, Th2 and Th17 cells, which produce different cytokines that drive distinct types of immune ... but rather required interactions with other hematopoietic cells [24,28] Selection through interactions with other hematopoietic cells is not a phenomena unique to CD8+ innate T cells Invariant...
- 10
- 312
- 0
Báo cáo khoa học: Human papillomavirus 16 E7 protein inhibits interferon-c-mediated enhancement of keratinocyte antigen processing and T-cell lysis docx
... forward, 5¢-ACC TGG CTA CGG TAC ACC TG-3¢; TAP1, reverse, 5¢-CCT CTG AGC TCC CAC TTG AC-3¢; IRF-1, forward, 5¢-CCT GGG TCA GGA CTT GGA TA-3¢; IRF-1, reverse, 5¢-TTC GGC TAT CTT CCC TTC CT-3¢; PA28, forward, ... forward, 5¢-CCG CTC CTC CTT CTC TTT CT-3¢; PA28, reverse, 5¢-AAG CCA AGG TGG ATG TGT TC-3¢; JAK1, forward, 5¢-TCA ACC TTC CCA AAG TGA CC-3¢; JAK1, reverse, 5¢-CAT GAC TCG CTG CAT GAA CT-3¢; PIAS1, ... concentrations of IFNs can contribute to the clearance of HPV-associated genital warts [36] Administration of proinflammatory mediators that can enhance antigen presentation by an IFNindependent pathway,...
- 9
- 352
- 0
Báo cáo khoa học: ERK and cell death: ERK location and T cell selection pdf
... cannot be ruled out Regardless, it is attractive to hypothesize that the differential compartmentalization of Ras ⁄ ERK pathways provides the thymocyte with the ability to distinguish between ... quantities of DAG at the plasma membrane and lead to Ras-GRP1 recruitment to that location Recent work has demonstrated that in T cells, PLCc1 activation leads to activation of Ras-GRP1 and its ... self-restricted, yet self-tolerant, T cell repertoire (reviewed in [2]) TCRs that bind self-peptide MHC with high affinity induce either anergy [3], receptor editing [4], deviation into regulatory T cell...
- 9
- 350
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25