antibacterial activity of tea polyphenols against c botulinum and other heat tolerant bacteria

Báo cáo y học: " In-vitro antiviral activity of Solanum nigrum against Hepatitis C Virus" pdf

Ngày tải lên : 11/08/2014, 21:21

... amplification of HCV NS3 forward primer: GGACGACGATGACAAGGACT; NS3 reverse: CCTCGTGACCAGGT Page of AAAGGT; GAPDH Forward: ACCACAGTCCATGC CATCAC: and GAPDH reverse; TCCACCACCCTGTT GCTGTA PCR was ... 40 20 Cont SNC SNH Concentration (ug) Figure Anti-HCV activity of chloroform and n-hexane fraction of Solanum nigrum Huh-7 cells were incubated with HCV serum and 100 μg/μl concentration of Solanum ... concentration HCV RNA of each sample Cy3STD / Res × coefficient IC = IU HCV / mL Fam STD / Res IC = internal control, which is specific for each lot Antiviral analysis of SN extract against HCV NS3 Protease...

7
419
0

Báo cáo khoa học: "Impaired antiviral activity of interferon alpha against hepatitis C virus 2a in Huh-7 cells with a defective Jak-Stat pathway" pdf

Ngày tải lên : 12/08/2014, 04:21

... N- and C- termini of HCV NS5A was amplified using sense and anti-sense overlapping primers (S/7529/GFP- 5’-GCCTCCTCTATGCCCCCCATGGTGAGC AAGGGCGAG-3’ and (AS/7547-7564/GFP 5’TCCAGGCTCCCCCTCGAGCTTGTACA ... primers (S/7547/ HCV- 5’-ATGGACGAGCTGTACAAG CTCGAGGGGGAGCCTGGA-3’) and anti-sense primer (AS/80598077/HCV-5’-GTCTTCCAGGAGGTCCTTCCACAC- Page of 16 3’) In fourth step, the F1, F2 and F3 PCR fragments ... 5’-ATCGAATTCATCGTGGCTGGCCA-3’; anti-sense 5’-CTAGAATTCGGCGCGAGCCCCTG-3’; probe 5’GCTTGGTGGTCGAATGGGCAG GTAGCCGGA-3’ Page of 16 in PBS, fixed in 4%-parformaldehyde for 30 minutes and then counter...

16
391
0

Tài liệu Báo cáo khoa học: The effect of small molecules in modulating the chaperone activity of aB-crystallin against ordered and disordered protein aggregation pdf

Ngày tải lên : 18/02/2014, 16:20

... The signiﬁcant decrease in the amount of precipitation in the presence of high concentrations of Arg-HCl in the absence of the chaperone precluded analysis of the effect of this concentration ... Results The effect of Arg-HCl on the chaperone activity of aB-crystallin is target protein-speci c In order to investigate the effect of Arg-HCl on the chaperone activity of aB-crystallin, we ... chaperone activity was not affected by increasing concentrations of Gly, but was completely abolished by intermediate and high concentrations of Lys-HCl, and was inhibited by GdnHCl in a concentration-dependent...

13
613
0

Báo cáo khoa học: Identiﬁcation of crucial residues for the antibacterial activity of the proline-rich peptide, pyrrhocoricin pot

Ngày tải lên : 08/03/2014, 10:20

... In the current study, we looked at the entry of pyrrhocoricin, drosocin and apidaecin into E coli cells and macrophages, host cells of intracellular bacteria such as Mycobacterium tuberculosis ... domains could interact with spatially and temporally separated bacterial components Concerning the speci c interaction between the antimicrobial peptides and bacterial DnaK, the antibacterial activity ... as inactive against E coli JC7623 as any other pyrrhocoricin fragments truncated to half size Connection between antibacterial activity and pyrrhocoricin binding to the D-E helix region of DnaK...

12
442
0

Báo cáo khoa học: The potent inhibitory activity of histone H1.2 C-terminal fragments on furin doc

Ngày tải lên : 16/03/2014, 13:20

... gcctt-3¢; n-h1 : 5¢-ccatgggcatgtccgagactgctcctgc-3¢, 5¢-ctcgagc aggctcttgagacccagct-3¢; c- h1 : 5¢-ccatgggcgtgagcaagggcacctt g-3¢, 5¢-ctcgagcttctttttgggtgcagcctt-3¢ The expression vectors were transformed ... The sequences of the constructions were veriﬁed by DNA sequencing The primer pairs for the cloning were as follows: F-h1: 5¢-ccatgggcatgtccgagactgctcctgc-3¢, 5¢-ctcgagcttctttttgggtgca gcctt-3¢; ... clone the gene of histone H1.2 The human and murine histone H1 cDNA sequences from the gene database were referred to design a pair of PCR primers as follows: 5¢-ATGTCCGAGAC (C ⁄ T)GCTCC(T ⁄ C) GC-3¢...

11
286
0

Báo cáo toán học: "Chemical composition and antibacterial activity of the essential oils from Launaea resedifolia L." docx

Ngày tải lên : 20/06/2014, 20:20

... abundance of overall chemical constituents The antibacterial activity besides several biological activities can be used in place of costly antibiotics for effective control of the food pathogens Competing ... folk medicine such as in bitter stomachic, skin diseases, and reported to have antitumor, insecticide, and cytotoxic activities The antimicrobial activities of coumarin constituents and the neuropharmacological ... The concentration of the identified compounds was computed from the GC peak total area without any correction factor 2.4 Antibacterial activity In recent years due to an upsurge in antibiotic-resistant...

13
455
0

báo cáo hóa học:" Chemical composition and antibacterial activity of the essential oils from Launaea resedifolia L." potx

Ngày tải lên : 21/06/2014, 17:20

... abundance of overall chemical constituents The antibacterial activity besides several biological activities can be used in place of costly antibiotics for effective control of the food pathogens Competing ... folk medicine such as in bitter stomachic, skin diseases, and reported to have antitumor, insecticide, and cytotoxic activities The antimicrobial activities of coumarin constituents and the neuropharmacological ... The concentration of the identified compounds was computed from the GC peak total area without any correction factor 2.4 Antibacterial activity In recent years due to an upsurge in antibiotic-resistant...

13
388
0

Báo cáo hóa học: " Chemical composition and antibacterial activity of the essential oils from Launaea resedifolia L" pdf

Ngày tải lên : 21/06/2014, 19:20

... the microorganism being tested Antibacterial activities of these essential oils were due to abundance of overall chemical constituents The antibacterial activity besides several biological activities ... to check possible activity of this solvent against the bacteria assayed The experiments were repeated three times 2.3 Identification of components 2.5 Chemical composition Identification of oil ... doi:10.1186/2191-2858-2-2 Cite this article as: Zellagui et al.: Chemical composition and antibacterial activity of the essential oils from Launaea resedifolia L Organic and Medicinal Chemistry Letters...

4
478
0

Báo cáo hóa học: " On the Enhanced Antibacterial Activity of Antibiotics Mixed with Gold Nanoparticles" pot

Ngày tải lên : 22/06/2014, 00:20

... antibacterial activity of penicillin G, amoxicillin, erythromycin, clindamycin, and vancomycin against Staphylococcus aureus and Escherichia coli [43] Similar conclusions were reported on the antibacterial ... antibacterial activity of an antibiotic–NP mixture in liquid culture, in which NPs or aggregates have a chance of coming into contact with bacterial cells because of Brownian motion The antibacterial ... the colloid color and extinction spectrum and also by direct TEM images Consequently, the absence of enhancement of the 123 Number of samples antibacterial action of the conjugates and particles...

8
228
0

Báo cáo khoa học " Lentinula edodes enhances the biocontrol activity of Cryptococcus laurentii against Penicillium expansum contamination and patulin production in apple fruits " ppt

Ngày tải lên : 28/06/2014, 11:20

... extracted with phenol-chloroform-isoamylic alcohol (25:24:1) and precipitated by adding 0.5 volume of cold 2-propanol 2.9 DNA ampliﬁcation Species-speci c primers (Pepg1_for 5′-GGT AAA AAC TCC CTC ... presence of other microrganims, such as biocontrol agents Early detection could be just as crucial for ensuring microbiological quality and safety of fruits and juices as is the optimization of ... biocontrol activity of C laurentii by complementing it with LF23 extract The role of LF23 extract consists of enhancing the antioxidant enzyme activity of the yeast colonising the apple wounds and controlling...

7
392
0

Báo cáo y học: " Differential activity of candidate microbicides against early steps of HIV-1 infection upon complement virus opsonizatio" pdf

Ngày tải lên : 10/08/2014, 05:21

... anti-HIV-1 activity of candidate microbicides BMC infectious diseases 2006, 6:150 Stoiber H, Speth C, Dierich MP: Role of complement in the control of HIV dynamics and pathogenesis Vaccine 2003, ... monolayer of human endometrial epithelial cells, HIV-1 capture by dendritic cells, and HIV-1 productive infection of dendritic cells by a panel of 10 microbicide candidate molecules Upon complement ... Such increased binding of HIV-1 could be explained by the expression on dendritic cells of complement receptors (CR3) Increased binding of HIV-1 could facilitate the infection of dendritic cells...

8
309
0

Báo cáo y học: " Insecticidal activity of two proteases against Spodoptera frugiperda larvae infected with recombinant baculoviruses Aline Welzel Gramkow, Simone Perecmanis, Raul Lim" pdf

Ngày tải lên : 12/08/2014, 04:20

... amplified by PCR using specific oligonucleotides (Protease F 5'-CCACCAGCAACCATCACCTTAAGCTTTAACAC-3') (Protease R 5'GAATTCAATTGAAAAAGGCAG-3') and DNA from the pKYH5 plasmid (courtesy of Dr Robert ... gene can also results in reduced infected-insect time to death and reduced economic damage to crops [21,23] Recombinant baculoviruses have also been constructed with enhancin genes from other baculoviruses ... tobacco budworm, Heliothis virescens, and cabbage looper Trichoplusia ni Proceedings of the Beltwide Cotton Conference: 911-917, Nashville 1996 Page of 10 15 Maeda S: Increased insecticidal effect...

10
328
0

Báo cáo khoa học: " Antibacterial Effect of Bovine Lactoferrin Against Udder Pathogen" doc

Ngày tải lên : 12/08/2014, 15:20

... curves of E coli FT238 in Iso Sensitest-Broth (ISB) with concentrations of 0.67, 1.67, and 2.67 mg/ml lactoferrin (Lf) and without Lf Acta vet scand vol 44 no 1-2, 2003 Antibacterial effect of ... treatment for this condition, but its efﬁcacy should be tested using in vivo studies Antibacterial effect of bovine lactoferrin Conclusions The antibacterial effects of Lf could only be demonstrated ... feeding and injection against systemic staphylococcal infections in mice J Appl Microb 1999, 86, 135-144 Dalmastri C, Valenti P Vittoriosso P, Orsi N: En, hanced antimicrobial activity of lactoferrin...

8
376
0

Photocatalytic Degradation of Isoproturon Pesticide on C, N and S Doped TiO2

Ngày tải lên : 26/03/2014, 00:20

... (C/ C0) pH7 Figure Effect of pH on solar photocatalytic isoproturon degradation over TCNS5 (Experimental conditions: C0 =1.14×10−4 M; catalyst amount = 1.0 g L−1.) Cycle i Cycle ii Cycle iii Cycle ... is confirmed by calcining the 3rd cycle used sample at 400 C for h and reused for the 4th cycle activity The original activity of the catalyst for degradation is restored This indicates that calcination ... excess dopent acts as recombination centers which facilitates electron-hole recombination thus lowering the activity So, the photocatalytic activity is depressed to a certain extent To conclude, the...

10
358
0

Báo cáo khoa học: Expression, puriﬁcation and catalytic activity of Lupinus luteus asparagine b-amidohydrolase and its Escherichia coli homolog potx

Ngày tải lên : 30/03/2014, 15:20

... complementary to each end of the ORF were synthesized (MWG Biotech, Ebersberg, Germany) as follows: EcoNase1 5¢-GACGAATACCATGGGCAAA GCAGTC-3¢ and EcoNase2 5¢-ACATTACCGGATC CAAGTTCACTGTGTGGC-3¢ These ... the Archaea and Cyanobacteria The branch of aspartylglucosaminidases is clearly separated and consists of two groups: bacterial and eukaryotic sequences In contrast to the archaeal branch, there ... separation of some branches One of the branches comprises mainly archaeal enzymes, another one contains eukaryotic and bacterial aspartylglucosaminidases, and the third group contains plant and bacterial...

12
407
0

Báo cáo vật lý: "Evaluation of In Vitro Antioxidant Activity of 5H-dibenz[b,f]azepine and Its Analogues" ppt

Ngày tải lên : 07/08/2014, 14:20

... mass spectroscopy and elemental analysis The IR spectra of compounds (e) and (f) showed the absent of the N–H absorption band at 3400 cm–1 and the presence of the C= O stretching band at 1600 cm–1, ... TBA, TCA, NaCl, ferric chloride, L-ascorbic acid, HCl and NaOH were of analytical grade and obtained from Merck, Mumbai, India Melting points of the compounds were determined by the open capillary ... incubation at 37oC for hr, the reaction was terminated by adding ml of 0.25 N HCl containing 150 mg/ml trichloroacetic acid (TCA) and 3.75 mg/ml of thiobarbutaric acid (TBA) The reaction mixture...

14
438
0

Development of transition metal catalyzed c s and c c cross coupling reactions

Ngày tải lên : 10/09/2015, 15:50

... and C- heteroatom bond formations Scheme 1.3: The generally accepted catalytic cycle of C C cross-coupling reactions Scheme 1.4: Preparation of palladium thiolato aryl complexes and its dissociation ... significant and untouched advanced in the literature until the mid 1990’s when Hartwig’s Chapter 1: General Introduction Scheme 1.3: The generally accepted catalytic cycle of C C cross-coupling ... In Chapter 3, the development of a new Cu(I) catalyzed direct thiolation of heterocycle C H bonds is describes In presence of CuI, 2,2′-bipyridine and cheaper base Na2CO3, a variety of thiols can...

0
150
0

Chemistry of cyclopentadienylchromium complexes containing c , n and s organic ligands

Ngày tải lên : 03/10/2015, 20:33

... Cr X Cr X OC CO Cp4Cr4S4 Cr OC CO S8 or Se2 As OC CO OC Cr Cr CO OC CO P4 P Cr P P Cr OC CO CO OC Cr P P OC P Cr P P P P Cr P P Cr P OC CO Cr P P P P Cr P OC Cr CO OC P OC P Cr P CO Cr P P OC ... OC OC Sb2S3 CO OC CO OC Cr S Sb Cr CO OC CO CO + Sb CO OC CO OC [CpCr(CO)2]2S CO 24 Cr 30 X P X X P P X X = S, Se Cr X P Cr OC P OC OC Cr OC CO CO P X P CO P OC OC + Cr OC Cr P Cr Cr CO OC CO ... OC CO Cr OC OC Cr Cr OC OC L L OC OC 2L CO X2 2L X CO X = H, Cl, Br, I OC CO OC Cr Cr RSSR Cr OC OC H2S Cr CO OC CO SR CO OC OC + HS H CO RX Bu3SnH RSH + Cr OC OC SnBu3 CO Cr OC OC + Cr OC OC...

150
357
0

WHO Guidelines for Pharmacological Management of Pandemic Influenza A(H1N1) 2009 and other Influenza Viruses potx

Ngày tải lên : 08/03/2014, 14:20

... septic shock. Other complications can include rhabdomyolysis and myocarditis. – Exacerbation of underlying chronic disease, including asthma, chronic obstructive pulmonary disease (COPD), chronic hepatic or renal insufficiency, diabetes, or other ... Infection control procedures should be rigorously applied in this context, including vaccination against seasonal and pandemic influenza in all persons who have direct contact with these patients. Other infection control procedures include hand hygiene, ... the context of prospective clinical and virological data collection as part of an approved research protocol. Of current concern is the mutation (H275Y) in the neuraminidase that confers ...

32
439
0

What is known about the effectiveness of economic instruments to reduce consumption of foods high in saturated fats and other energy-dense foods for preventing and treating obesity? docx

Ngày tải lên : 17/03/2014, 08:20

... 2006 In the case of tobacco and alcohol control, the effectiveness of economic instruments is mediated by social and cultural factors For both tobacco and alcohol control, evidence suggests that ... price of rice raised consumption of wheat flour and coarse grains Increases in the price of pork led to increases in consumption of wheat flour, coarse grains and edible oils, but decreases in consumption ... tobacco and alcohol Studies of tax and price policies applied to tobacco and alcohol products in many countries provide persuasive evidence of their decreasing consumption of these products These...

25
551
0