announcement of acceptance levels this rule is disapplied in a scheme

the art of printmaking and how it is done in other countries

Ngày tải lên : 21/03/2014, 22:52

1
612
0

– THE GRE QUANTITATIVE SECTION – The area of a sector is found in a similar way to ﬁnding the pptx

Ngày tải lên : 18/06/2014, 17:20

... a decrease A flat line indicates no change as time elapses – THE GRE QUANTITATIVE SECTION – Percentage and Probability Part of data analysis is being able to calculate and apply percentages and ... Review Many questions on the GRE will test your ability to analyze data Analyzing data can be in the form of statistical analysis (as in using measures of central location), finding probability, and ... angles are equal and the ratio of the corresponding sides is in proportion Parallelograms A parallelogram is a quadrilateral with two pairs of parallel sides B A C D In this figure, AB ʈ ෆD and BC...

25
410
0

Báo cáo hóa học: " Expression of frog virus 3 genes is impaired in mammalian cell lines" pot

Ngày tải lên : 20/06/2014, 01:20

... AAGATGGACGACAAG3') and FV3-75L-reverse (5'CTCGAGCTACAGATCTTCTTCAGAAATAAGTTTTTGTTCTAAAATTTTGTA CACAAACAC-3'), and 2.5 U of Taq DNA polymerase U/μL (Invitrogen) was used to amplify FV3-75L and add a ... calcarifer Diseases of Aquatic Organisms 1994, 18:95-102 Naegele RF, Granoff A: Viruses and renal carcinoma of Rana pipiens XI Isolation of FV3 temperature-sensitive mutants; complementation and ... 5:83 This data demonstrates that at least one FV3 gene does not produce detectable proteins in mammalian cell lines We believe that the lack of 75L expression is not unique to this gene as we have...

7
308
0

Báo cáo sinh học: " Genetic structure of the Marseilles cat population: is there really a strong founder effect ?" potx

Ngày tải lên : 09/08/2014, 18:21

... Barcelona, Palma in Majorca, Murcia in Spain, Rimini in Italy, Buenos Aires in Argentina, and Jerusalem and Tel-Aviv in Israel; Ruiz-Garcia, 1991, 1993ab) and where the a and, especially, the t alleles ... be analyzed using a spatial autocorrelation analysis Statistical heterogeneity and patterns are mutually independent of each other For this reason, we can analyze the possible and logical combinations ... to imagine in this case) between these different areas of Marseilles, which may have some selective influence on this gene All this taken into account, a neutral point of view could be taken...

15
331
0

báo cáo khoa học: "SMI of Bcl-2 TW-37 is active across a spectrum of B-cell tumors irrespective of their proliferative and differentiation status" pptx

Ngày tải lên : 10/08/2014, 22:20

... Cleavage of caspase 9,lines PARP protein and induction of Caspase 3, activity and resulting DNA fragmentation in TW-37 Cleavage of caspase 9, and PARP protein and induction of Caspase 3, activity ... of patients with CLL Caspase activation, PARP cleavage and DNA fragmentation Exposure of WSU-FSCCL cells to TW-37 induced activation of caspase and caspase activity and PARP cleavage Page of 13 ... lymphoma cells and established cell lines to TW-37 was associated with activation of caspase and 9, cleavage of the polyadenosine ribose polymerase (PARP) into active fragments and DNA fragmentation...

13
236
0

Báo cáo y học: " Inhibition of SOC/Ca2+/NFAT pathway is involved in the anti-proliferative effect of sildenafil on pulmonary artery smooth muscle cells" pps

Ngày tải lên : 12/08/2014, 14:20

... depletion is the dominated component of CCE [16] Ca2+ influx via SOC appears to be a determinant in maintaining a sustained increase in [Ca2+]i and regulation of vascular tone and arterial wall structure ... localization, was observed in PASMC isolated from idiopathic PAH patients, suggesting enhanced NFAT activation might contribute to vascular remodeling in this disease [13] Calcineurin, a calcium- and calmodulin-dependent ... sildenafil may operate through other signaling molecules in addition to the NO/cGMP axis by targeting PKG/PKA [5] Nuclear factor of activated T-cells (NFAT) is a signal integrator of Ca2+ signal and...

14
403
0

Báo cáo y học: "Inhibition of breathing after surfactant depletion is achieved at a higher arterial PCO2 during ventilation with liquid than with gas" ppsx

Ngày tải lên : 12/08/2014, 18:21

... temperature, measured as deep rectal temperature, was maintained at 38°C by a heating blanket and an overhead warmer A pretracheal midline incision was performed for preparation of the trachea, ... statistical evaluation, Sigmastat® (SPSS Inc, IL, USA) was used The amplitude of the integrated PNA was monitored and inhibition of spontaneous breathing activity was defined as total disappearance of ... than after lavage during GV After lavage, PIP and Ptp were similar at inhibition during GV and during PLV After lavage, compliance at inhibition remained the same during GV and PLV and resistance...

8
257
0

DETOXIFICATION OF TRICHLOROETHYLENE (TCE) USING SOLAR LIGHT/TiO2 IN A UV CONCENTRATING RADIATION SYSTEM

Ngày tải lên : 05/09/2013, 08:40

... degradation were examined MATERIALS AND METHODS TCE (99+%) was obtained from Aldrich Chemical Co, and the TiO2 used was Degussa P-25, which was mostly anatase and had a BET surface area of 50-m2/g ... Figure Schematic diagram of photocatalytic solar reactor - 39 - The dark reaction was initially carried out by injecting a sampling of TCE into the slurry of TiO2 to given a final solution of 50 ppm ... in one-pass solar detoxification system (Pacheco et al., 1993) and contaminated surface water can be treated in a UV concentrating radiation System (Yves et al., 1996) In this process, major toxic...

6
392
0

EFFECTS OF RESIDUAL COD ON MICROBIAL GROWTH KINETICS IN A NITRIFYING UCBR

Ngày tải lên : 05/09/2013, 08:40

... 400µm This suggested that sloughing of outer biofilm layers - 95 - may have taken place after de-coupling This could have resulted in nitrifying bacteria in inner layers being sheared off during ... heterotrophic bacteria indicated the presence of heterotrophic bacteria in the biofilm even in the absence of COD in Phases and This observation is similar to the findings of Rittmann et.al (1994) After ... maintained at above 4.0 mg/L throughout the experiment pH of the reactor was maintained at 7.5 + 0.3 with manual addition of acid (HCl) and base (NaHCO3) Approximately 15 ml of biofilm particles...

6
446
0

Optimal placement of horizontal - and vertical - axis wind turbines in a wind farm for maximum power generation using a genetic algorithm

Ngày tải lên : 05/09/2013, 17:03

... in section demonstrate that the layout optimization of a wind farm of HAWT using GA gives a uniform grid arrangement similar that obtained by Grady et al [2]; this is different than that obtained ... analysis of the single stream tube model for a two-dimensional single straight-blade vertical axis wind turbine The geometry of this simple model is shown in Figure 3; the blade is rotating in ... Mechanical Engineering from Shanghai Jiao Tong University in China in 2008 and M.S in Mechanical Engineering from Washington University in St Louis in 2010 Xiaomin's research focuses on wind...

12
635
1

Tài liệu Clinical presentation and outcome of patients diagnosed with active pulmonary tuberculosis in a large critical care unit docx

Ngày tải lên : 15/02/2014, 12:20

... applicable Variations within categories are shown as means with ranges where appropriate Comparative data between characteristics are displayed, and data are summarized as tables as well as in ... the statistical significance of some of the findings Also, retrospective analyses such as this are dependent on available data This is a major disadvantage in retrospective study design A larger ... awareness King Fahad National Guard Hospital is an 800-bed tertiary care hospital located in the central region of the Kingdom of Saudi Arabia (KSA), provides multilevel health care for National Guard...

6
506
0

Tài liệu Báo cáo khoa học: Properties of ecdysteroid receptors from diverse insect species in a heterologous cell culture system – a basis for screening novel insecticidal candidates docx

Ngày tải lên : 18/02/2014, 08:20

... on the aromatic moiety of dibenzoylhydrazines on larvicidal activity against the Colorado potato beetle Leptinotarsa decemlineata Pest Manag Sci 57, 858–865 Nakagawa Y, Minakuchi C, Takahashi K ... region and ligand-binding domain (LBD) of ecdysone receptors Fig S2 Amino acid alignment of linker region and ligand-binding domain (LBD) of ultraspiracle ⁄ RXR receptors This supplementary material ... over a dosage range (A) DmEcRB2 (B) EcRA (C) LdEcRB All luciferase activity levels were normalized on the basis of b-galactosidase activity as a measure of cell mass For each agonist, fold inductions...

12
627
0

Predictors of relapse among pulmonary tuberculosis patients treated in a DOTS programme in South India pot

Ngày tải lên : 06/03/2014, 04:20

... time and L Ranganathan of the EDP department for supplying the data output The secretarial assistance rendered by A Gopinathan is also acknowledged This report was funded in part by a grant from ... recaída fueron la resistencia inicial a isoniacida, a rifampicina o a ambas (aOR 4,8 ; IC95% 2,0–11,6) y el tabaquismo (aOR 3,1 ; IC95% 1,6–6,0) La tasa de recaída en los pacientes no fumadores buen ... resistance and with HR resistance (two of the three had initial resistance to HR) Risk factors for relapse On univariate analysis, drug irregularity, initial drug resistance, smoking and alcoholism...

6
532
0

Báo cáo khoa học: "LANGUAGE SYNTHESIS GENERATION OF GERMAN FROM CONCEPTUAL STRUCTURE: MT PROJECT IN A JAPANESE/GERMAN" pot

Ngày tải lên : 08/03/2014, 18:20

... employ Winograd's terminology for functional gran~nar (Winograd, 1983) In general, case schemata will be mapped into CLAUSE-RS and concept schemata are mapped into NP-R~ A CLAUSE-RS has a features ... nodes and labelled arcs The names of the node are called "semantic symbols" and are associated with Japanese and English dictionary entries The labelled arcs are used in two ways: a) Binary arcs either ... German In this example the WANT and ACHIEVE nodes (flagged by a FRED arc) are case schemata Applying their tranformation rules results in the following IKBS: is no Agent, so we choose to build a...

4
358
0

Báo cáo khoa học: Tumor suppressor p16INK4a: Downregulation of galectin-3, an endogenous competitor of the pro-anoikis effector galectin-1, in a pancreatic carcinoma model pptx

Ngày tải lên : 29/03/2014, 21:20

... p16INK 4a downregulates anti-anoikis effector Gal-3 H Sanchez-Ruderisch et al chains, such as status of sialylation, have a bearing on protein functions in general and on integrins in particular ... hypothesis This hypothesis was verified by combining glycogene microarray analysis, chromatographic glycan profiling and lectin binding [9] In uencing N- and O-glycan galactosylation and sialylation, ... suppressor and lectin ⁄ glycan remodeling as an effector pathway, especially by examining clinical samples, is clearly justified Examining galectin expression in clinical samples of pancreatic cancer...

12
373
0

Báo cáo sinh học: " Stimulation of poliovirus RNA synthesis and virus maturation in a HeLa cell-free in vitro translation-RNA replication system by viral protein 3CDpro" docx

Ngày tải lên : 19/06/2014, 08:20

... lower affinity binding determinants are located in the 3Dpol domain [27,28] We have recently shown that a mutation (3CproR8 4A/ I8 6A) in the RNA binding domain of 3CDpro abolishes that ability of ... incorporation of label into polymer using a filter-binding assay As shown in Fig 2A, RNA synthesis is maximal hrs after the start of translation and by 16 hr the total amount of RNA present in the reaction ... Utilization of a mammalian cell-based RNA binding assay to characterize the RNA binding properties of picornavirus 3C proteinases RNA 1998, 4(2):215-225 Hammerle T, Molla A, Wimmer E: Mutational analysis...

19
489
0

báo cáo hóa học: " Initiation of health-behaviour change among employees participating in a web-based health risk assessment with tailored feedback" pptx

Ngày tải lên : 20/06/2014, 00:20

... level and caloric intake, smoking status, and Framingham CVD risk score as a proxy for cardiovascular risk factor levels) as covariates The Framingham score estimates 10-year CVD mortality and ... simultaneously increasing awareness of risk and enhancing initiation of health-behaviour change[11,15] Despite this potential little has been documented regarding health-behaviour change after implementation ... and high risk, defined as 10-year CVD risk of

7
538
0

$báo cáo hóa học:" Fatigue behavior of Ilizarov frame versus tibial interlocking nail in a comminuted tibial fracture model: a biomechanical study" pptx$

báo cáo hóa học:" Fatigue behavior of Ilizarov frame versus tibial interlocking nail in a comminuted tibial fracture model: a biomechanical study" pptx

Ngày tải lên : 20/06/2014, 00:20

... comparison of biomechanical properties of an Ilizarov frame versus an interlocking nail in a comminuted tibia fracture model Interestingly, the amplitude of the change in fracture gap distance and ... results indicate that both the Ilizarov frame and a statically locked intramedullary nail are able to maintain fracture stability over three months of normal clinical use in a comminuted tibial defect ... biomechanical testing experiments and assisted with analysis of the data and writing of the manuscript EH and GCP analyzed the data and wrote the final version of the manuscript WRS, PFS, and SJM...

6
332
0

$báo cáo hóa học:" Base of coracoid process fracture with acromioclavicular dislocation in a child" ppt$

báo cáo hóa học:" Base of coracoid process fracture with acromioclavicular dislocation in a child" ppt

Ngày tải lên : 20/06/2014, 04:20

... of acromioclavicular joint maintained but there was disruption of the acromioclavicular joint capsule The treatment of this type of injury is rather controversial Both operative and non-operative ... epiphyseal plate is weaker than the coracoclavicular ligaments Interestingly, we describe a rare injury in this twelve year old boy with an avulsion fracture of base of coracoid with acromioclavicular ... dislocation of the acromioclavicular joint and fracture of base of coracoid process latter mechanism is believed to account for fracture patterns seen in children A coracoid fracture can be isolated...

4
277
0