an interdisciplinary approach to developing a probabilistic risk analysis model applications to a beef slaughterhouse
Báo cáo y học: "Sustained remission of rheumatoid arthritis with a specific serotonin reuptake inhibitor antidepressant: a case report and review of the literature" ppsx
... in modulating inflammatory pain, compared with mechanistic pain Antidepressants have anti-inflammatory and analgesic properties Antidepressants with a dual action (inhibiting serotonin and norepinephrine ... escitalopram, it was decided gradually Page of to taper and stop his antidepressants On stopping the antidepressants, his joint pain and stiffness started to worsen, and in two weeks, at the patient’s ... response to pathogen proteins and endogenous molecules found at sites of inflammation and tissue damage 5-HT 2A receptors mediate the inflammatory response to serotonin Recent animal and human data suggest...
- 5
- 318
- 0
formation of zno thinfilms consisting of nano-prisms and nano-rods with a high
... Na3-citrate and Al(NO3)$ 6H2O as surfactant chemicals in the hydrothermal synthesis at 60 C Experimental details Zinc nitrate hexahydrate (Zn(NO3)$6H2O) was used to grow ZnO crystals, and aluminum ... ZnO seeded layer and substrate were very sharp without any indication of an interfacial reaction or any formation of amorphous compounds The SAED pattern showed that the film was c-axis oriented ... chemical [18], was not observed in the sample grown in solution D, which contained both Na3C6H5O7 and Al(NO3)$6H2O as the surfactant chemicals These characteristics were attributed to the surfactant...
- 5
- 274
- 0
Báo cáo hóa học: "Reference values and physiological characterization of a specific isolated pig kidney perfusion model" doc
... indicator for the performance of the isolated pig kidney Materials and methods Animals and experimental groups After approval of the local official veterinarian institutions, German landrace female ... gas analysator (Radiometer Copenhagen, ABL) to assess pH- and electrolyte status Further sample fractions were stored for a later Kidneys from laboratory animals were handled in the same way after ... removed surgically For organ harvesting by surgery, pigs were set under general anesthesia undergoing median laparotomy The right external jugular vein was cannulated and the animal was heparinized...
- 13
- 548
- 0
Báo cáo khoa học: "Commissioning and early experience with a new-generation low-energy linear accelerator with advanced delivery and imaging functionalities" doc
... contribution AF and LC coordinated the study Data acquisition and data analysis were done by AC, EV, GN, AF The manuscript was prepared by LC and GN All authors read and approved the final manuscript ... for AAA can be found in Fogliata et al [6] In summary, the AAA configuration phase consisted in the optimisation of parameters and calculation kernels against the measured beam data The optimisation ... collimator and couch angle settings ii) Output factors Output factors were measured for squared and rectangular fields in water at 10 cm depth and data were compared against performed calculations...
- 29
- 344
- 0
Báo cáo y học: "gA retroperitoneal abscess caused by Haemophilus parainfluenza after endoscopic retrograde cholangiopancreatography and open cholecystectomy with a common bile duct exploration: a case report" ppt
... parainfluenza is a normal inhabitant of the human respiratory tract and its route of translocation into the gastrointestinal tract is largely unknown We postulate that, in this case, the H parainfluenza ... occurrence to extra-respiratory infections, assisted in compiling the manuscript, and also carried out chart review, as well as obtaining images ZH carried out the search and obtained data on H parainfluenza, ... morphology A CT-scan was obtained and indicated a fluid collection suggesting an abscess of the right flank (figure 1) Our patient was taken to the operating room where a retroperitoneal abscess was...
- 3
- 242
- 0
Báo cáo y học: " A gastrointestinal stromal tumour presenting incidentally with haemorrhage and perforation associated with a Meckel’s diverticulum: a case report" pps
... was diagnosed clinically and a diagnostic laparoscopy performed A perforated Meckel’s diverticulum was found, associated with free intra-abdominal fluid and haemorrhage At subsequent laparotomy, ... hernia [7] Due to the rarity of this anatomical abnormality, symptomatic Meckel’s diverticula are misdiagnosed in approximately 90% of cases and acute appendicitis is the usual preoperative diagnosis ... twice as often in men [1] Although approximate guidelines describe this anatomical variant, they are not accurate The diagnosis of a Meckel’s diverticulum is often incidental at laparotomy or laparoscopy...
- 5
- 207
- 0
Báo cáo y học: "Dialectical Behavioral Therapy for Adolescents (DBT-A): a clinical Trial for Patients with suicidal and self-injurious Behavior and Borderline Symptoms with a one-year Follow-up" pot
... statistical analysis, all patients who had started the therapy program were included in the data set (intentto-treat analysis) Changes occurring prior to therapy (t ), four weeks after therapy (t2 ) and ... Regarding aspects such as family, social contact with peers and physical health, a tendency towards amelioration was Fleischhaker et al Child and Adolescent Psychiatry and Mental Health 2011, ... year after therapy (t3) Frantic efforts to avoid real or imagined abandonment A pattern of unstable and intense interpersonal relationships characterized by alternating between extremes of idealization...
- 10
- 449
- 0
Báo cáo y học: "Blunt traumatic pericardial rupture and cardiac herniation with a penetrating twist: two case reports" ppt
... pleuropericardium or the diaphragmatic pericardium The defect can allow cardiac luxation and, in the case of diaphragmatic pericardial tear, herniation of abdominal contents into the pericardial sac Clarke ... dose norepinephrine and epinephrine to sustain his mean arterial pressure He was re-trauma called at this stage and plain radiographs were obtained to further ascertain and clarify his injuries ... else of significance He became increasingly agitated and hypoxic and was intubated prior to transfer for computed tomography (CT) scan to be on a FiO2 of 1.0 with PaO2 around 10 kPa and requiring...
- 7
- 260
- 0
money and trade considered, with a proposal for supplying the nation with money
... valued at Thus Exchange rose above the Par, and became a Trade Mr Mun on Trade Page 100, says, The Exchange being against a Nation, is of advantage to that Nation and supposes, if a 100 lib at ... prefer'd to Money, every Body knowing such a stop may happen to the Bank, and that Gold-smiths and Bankers may fail The other Objection is the same as to say, a Merchant who had a small Stock, ans was ... of Holland would be sold as cheap in Scotland Exchange, is when a Merchant exports to a greater Value than he Imports, and has Money due Abroad; Another importing to a greater value than he exported,...
- 133
- 215
- 0
The herpetofauna of the peruvian dry forest along the andean valley of the marañón river and its tributaries, with a focus on endemic iguanians, geckos and tegus
... tamandua (Tamandua mexicana), the Sechuran fox (Pseudalopex sechurae), the puma (Puma concolor), the jaguar (Panthera onca), the ocelot (Leopardus pardalis) the tayra (Eira barbara), the collared ... Duellman & Pramuk 1999) along the flanks of the Chinchipe, Chamaya, Huancabamba and Utcubamba rivers and tributaries (Regions Piura, Cajamarca, Amazonas) southwards along the deep and narrow valleys ... Southern part of the Region Amazonas, in Chacanto, Region Cajamarca and in various localities in the Region La Libertad (San Vicente/Pusac, Santa Rosa/El Tingo, Vijus, Chagual, Calemar, and Pias) at...
- 264
- 492
- 0
Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt
... acid-substituted SP analogues [HGly9]SP, [b2-HAla9]SP and [b3-HAla9]SP may adopt conformations around residue that are analogous to those adopted by a- amino acids (Gly, Ala, Sar, Pro) To explain the slightly ... C-terminal heptapeptide of NKA, another peptide of the tachykinin family that binds the NK-1 and NK-2 receptors [HGly8] NKA(4–10) is as potent as NKA and [Ala8]NKA on rabbit pulmonary artery and rat ... considered as a switch point between agonist and antagonist structures [21–23] By molecular mechanics calculations the conformers of Ac-HGly-NHMe, Ac-b2-HAla-NHMe and Ac-b3-HAlaNHMe have been generated...
- 11
- 860
- 0
Báo cáo Y học: Selection of effective antisense oligodeoxynucleotides with a green fluorescent protein-based assay Discovery of selective and potent inhibitors of glutathione S-transferase Mu expression doc
... AS-15 TGAGAGCTGAAAGCAGGTCCAT G *A* GCTGCACGCTGCCG*T*C GGCGGATCGGGTGTGTCAGC CCACTGGCTTCTGTCATAGT GAAGTCCAGGCCCAGTTTGA TCAATTAAGTAGGGCAGATT TCTCCAAAACGTCCACACGA ACAAAGCATGATGAGCTGCA GAGTAGAGCTTCATCTTCTC ... GAGTAGAGCTTCATCTTCTC ACTGGTCAAGAATGTCATAA CAGGTTTGGGAAGGCGTCCA CAGGCCCTCAAACCGAGCCA GTCTGGACTTTGTGGTGCTA GGCATGACTGGGGTGAGGTT AAAATCAGTGAGGGAAGGGT TCTAATCTCTCAGGCCAGGC GCAGCTCCCCCACCAGGAAC Unrelated GFP–CDS ... CCATGCCTATGATACTGGGAT-3¢ GSTM1-revA 5¢- CTAAAGATGAGACAGGCCTGG-3¢ GSTM1-revB 5¢-GATCCTAAAGATGAGACAGGCCTGG-3¢ GSTM2-forA 5¢-AATTCGATGCCTATGACACTGGGTTAC-3¢ GSTM2-forB 5¢- CGATGCCTATGACACTGGGTTAC-3¢...
- 10
- 432
- 0
Báo cáo hóa học: " Comparison of three rapamycin dosing schedules in A/J Tsc2+/- mice and improved survival with angiogenesis inhibitor or asparaginase treatment in mice with subcutaneous tuberous sclerosis related tumors" docx
... p-value ≤ 0.05 indicating statistical significance All calculations were completed from raw data by two researchers (AN and CW) A standard unpaired t test was used to test all quantitative data, ... experimental design, performed data collection and statistical analyses, and wrote and helped edit the manuscript AN assisted with experimental design, performed data collection and statistical analyses, ... Rapamycin (Rapamune™ or sirolimus, Wyeth, Madison, NJ) is a macrolide antibiotic that acts to inhibit the mTOR pathway and is FDA approved for use as an immunosuppressant following organ transplantation...
- 18
- 611
- 0
Báo cáo sinh học: "Gene therapy with tumor-specific promoter mediated suicide gene plus IL-12 gene enhanced tumor inhibition and prolonged host survival in a murine model of Lewis lung carcinoma" pptx
... of LLC ANOVA analysis as appropriate Kaplan-Meier curves were compared using the log-rank test In all cases, P values less than 0.05 were considered statistically significant Analysis was performed ... serum analysis for biochemical markers of liver and kidney and the histological examination of hematoxylin and eosin stained major organs (Figure 5) Taking all these data into consideration, it appears ... was determined using a sandwich ELISA (R&D systems, CA, USA) according to the manufacturer’s instructions Immunohistochemical analysis and apoptosis assay Tumor tissues were formalin fixed and...
- 10
- 696
- 0
báo cáo hóa học: " The possible link between the elevated serum levels of neurokinin A and anti-ribosomal P protein antibodies in children with autism" pot
... elevated serum levels of neurokinin A and anti-ribosomal P protein antibodies in children with autism Gehan A Mostafa1,2, Laila Y AL-Ayadhi1 Autism Research and Treatment Center, AL-Amodi Autism ... were analyzed by commercially available software package (Statview, Abacus concepts, inc., Berkley, CA, USA) The data were non-parametric, thus they were presented as median and interquartile range ... Y Acad Sci 2008; 1144:74-82 41- Cohly HH, Panja A Immunological findings in autism Int Rev Neurobiol 2005; 71:317-341 42- Vojdani A, Campbell AW, Anyanwu E, Kashanian A, Bock K, Vojdani E Antibodies...
- 30
- 522
- 0
Báo cáo hóa học: " Nucleotide mismatches between the VP7 gene and the primer are associated with genotyping failure of a specific lineage from G1 rotavirus strains" potx
... Dutta P, Bhattacharya SK, Krishnan T, Kobayashi N, Naik TN: Genetic variability of human rotavirus strains isolated from Eastern and Northern India J Med Virol 2004, 72:156-161 Rahman M, Sultana ... site Arch Virol 1997, 142:1881-1887 Taniguchi K, Wakasugi F, Pongsuwanna Y, Urasawa T, Ukae S, Chiba S, Urasawa S: Identification of human and bovine rotavirus serotypes by polymerase chain reaction ... from database, performed the sequences analysis and critically revised the manuscript 14 16 18 19 Acknowledgements We are grateful to Natalia Gudiño for the language corrections of the manuscript,...
- 4
- 329
- 0
báo cáo hóa học:" Gene therapy with tumor-specific promoter mediated suicide gene plus IL-12 gene enhanced tumor inhibition and prolonged host survival in a murine model of Lewis lung carcinoma" doc
... of LLC ANOVA analysis as appropriate Kaplan-Meier curves were compared using the log-rank test In all cases, P values less than 0.05 were considered statistically significant Analysis was performed ... serum analysis for biochemical markers of liver and kidney and the histological examination of hematoxylin and eosin stained major organs (Figure 5) Taking all these data into consideration, it appears ... was determined using a sandwich ELISA (R&D systems, CA, USA) according to the manufacturer’s instructions Immunohistochemical analysis and apoptosis assay Tumor tissues were formalin fixed and...
- 10
- 485
- 0
Báo cáo y học: "Validation of a specific measure to assess healthrelated quality of life in patients with schizophrenia and bipolar disorder: the ‘Tolerability and quality of life’ (TOOL) questionnaire" doc
... alliances and treatment adherence among patients with schizophrenia and bipolar disorder Additional material Additional file 1: TOOL Spanish version The Spanish version of the ‘TOlerability and ... El-Mallakh RS, Elmaadawi AZ, Loganathan M, Lohano K, Gao Y: Bipolar disorder: an update Postgrad Med 2010, 122:24-31 Buckley PF: Update on the etiology and treatment of schizophrenia and bipolar ... 178:510-517 Page of 20 Colom F, Vieta E, Martínez-Arán A, Garcia-Garcia M, Reinares M, Torrent C, Goikolea JM, Banús S, Salamero M: Spanish version of a scale for the assessment of mania: validity and...
- 8
- 476
- 0
Báo cáo y học: "Association of a specific haplotype across the genes MMP1 and MMP3 with radiographic joint destruction in rheumatoid arthritis" ppt
... It evaluates 38 joints separately (all proximal interphalangeal and metacarpophalangeal joints, four sites in the wrists, interphalangeal joints of the great toes, and metatarsophalangeals to 5) ... to primary sclerosing cholangitis Gastroenterology 2001, 121:124-130 25 Terashima M, Akita H, Kanazawa K, Inoue N, Yamada S, Ito K, Matsuda Y, Takai E, Iwai C, Kurogane H, Yoshida Y, Yokoyama ... the Ratingen score) was used as a quantitative measure (Ratingen score) and analysed by factorial regression All P values from regression analyses were also checked empirically by means of a bootstrap...
- 9
- 357
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25