an exception class can carry a message of any type

Tài liệu Báo cáo khoa học: Understanding the binding properties of an unusual metal-binding protein ) a study of bacterial frataxin pdf

Tài liệu Báo cáo khoa học: Understanding the binding properties of an unusual metal-binding protein ) a study of bacterial frataxin pdf

Ngày tải lên : 18/02/2014, 16:20
... ratios: at a : Fe2+ ⁄ protein ratio, the resonances of Arg20, Asp22 and Asp23 disappeared, and the resonance of Leu21 shifted At a : ratio, the resonances of residues 19 and 44 also disappeared, ... ⁄ iron ratio were again those of Arg20, Leu21, Asp22 and Asp23 At a : ratio, the above resonances disappeared completely, together with those of the amides of residues 29, 30 and 31 At a : protein ... observed disappearance of the resonances of residues 23 and 27 at a 0.5 : Lu3+ ⁄ CyaY ratio The resonances of residues 18, 19, 22, 24, 25, 28, 29, 44 and 105 shifted gradually, and were bleached up...
  • 12
  • 704
  • 0
Tài liệu Báo cáo khoa học: "ModelTalker Voice Recorder – An Interface System for Recording a Corpus of Speech for Synthesis" ppt

Tài liệu Báo cáo khoa học: "ModelTalker Voice Recorder – An Interface System for Recording a Corpus of Speech for Synthesis" ppt

Ngày tải lên : 20/02/2014, 09:20
... accurately track the pitch of an utterance In these cases, the utterance will be marked unacceptable and the user should rerecord, hopefully yielding an utterance with more accurate pitch tracking Amplitude: ... of each utterance and gives the user feedback on whether the pitch is within an acceptable range This feedback mechanism also helps to eliminate cases in which the system is unable to accurately ... include automatic microphone calibration, pitch, amplitude, and pronunciation detection and feedback, and automatic phoneme labeling of speech recordings 1.2.1 Microphone calibration One important...
  • 4
  • 419
  • 0
Báo cáo sinh học: "An NIH intramural percubator as a model of academic-industry partnerships: from the beginning of life through the valley of death" pptx

Báo cáo sinh học: "An NIH intramural percubator as a model of academic-industry partnerships: from the beginning of life through the valley of death" pptx

Ngày tải lên : 18/06/2014, 19:20
... scenario may be an important feature of the percubator, particularly in light of today’s usual translational approach: a) academia hands off an application to the private sector only if and when ... MRE-B is a translational researcher who has participated in many laboratory and clinical research studies, as well as several successful biotechnology company start-ups, both privately and in his ... And as a practical matter, designating percubator investigators and their companies as ‘contractors and contract companies’ would be a simple route to initiating a pilot program in Bethesda as...
  • 4
  • 395
  • 0
báo cáo hóa học:" An NIH intramural percubator as a model of academic-industry partnerships: from the beginning of life through the valley of death" ppt

báo cáo hóa học:" An NIH intramural percubator as a model of academic-industry partnerships: from the beginning of life through the valley of death" ppt

Ngày tải lên : 20/06/2014, 03:20
... scenario may be an important feature of the percubator, particularly in light of today’s usual translational approach: a) academia hands off an application to the private sector only if and when ... MRE-B is a translational researcher who has participated in many laboratory and clinical research studies, as well as several successful biotechnology company start-ups, both privately and in his ... And as a practical matter, designating percubator investigators and their companies as ‘contractors and contract companies’ would be a simple route to initiating a pilot program in Bethesda as...
  • 4
  • 417
  • 0
Báo cáo hóa học: " Research Article An Iterative Soft Bit Error Rate Estimation of Any Digital Communication Systems Using a Nonparametric Probability Density Function" pptx

Báo cáo hóa học: " Research Article An Iterative Soft Bit Error Rate Estimation of Any Digital Communication Systems Using a Nonparametric Probability Density Function" pptx

Ngày tải lên : 21/06/2014, 23:20
... random variable X depends on both the type of receiver and the channel model; Gaussian function for a simple additive white Gaussian noise (AWGN) channel, a mixture of Gaussian functions for an ... consider any point to point system communication over any channel transmission (Gaussian, multipath fading, etc.) with or without channel coding using any transmission techniques (CDMA, MC-CDMA, TDMA, ... that we can easily show that for a zero mean and unit variance Gaussian kernel, we have M(K) = X Q i , N i=1 hN (18) N → +∞ The following theorem shows that the variance of the suggested estimator...
  • 9
  • 340
  • 0
Báo cáo khoa học: "Density of CD4(+) and CD8(+) T lymphocytes in biopsy samples can be a predictor of pathological response to chemoradiotherapy (CRT) for rectal cancer" ppt

Báo cáo khoa học: "Density of CD4(+) and CD8(+) T lymphocytes in biopsy samples can be a predictor of pathological response to chemoradiotherapy (CRT) for rectal cancer" ppt

Ngày tải lên : 09/08/2014, 09:20
... retrieval and analysis KY, KK, ES participated in immunostaining and data analysis HN participated in the management of this study All authors read and approved the final manuscript Page of Competing ... chemoradiation for rectal cancer Cancer 2007, 109(9):1750-1755 Park HC, Janjan NA, Mendoza TR, Lin EH, Vadhan-Raj S, Hundal M, Zhang Y, Delclos ME, Crane CH, Das P, et al: Temporal Patterns of Fatigue ... Kitayama J, Yasuda K, Kawai K, Sunami E, Nagawa H: Circulating lymphocyte number has a positive association with tumor response in neoadjuvant chemoradiotherapy for advanced rectal cancer Radiat...
  • 6
  • 371
  • 0
báo cáo khoa học: "Long-term misuse of zopiclone in an alcohol dependent woman with a history of anorexia nervosa: a case report" pps

báo cáo khoa học: "Long-term misuse of zopiclone in an alcohol dependent woman with a history of anorexia nervosa: a case report" pps

Ngày tải lên : 11/08/2014, 02:22
... abnormalities She had a long history of both anorexia nervosa and alcohol dependence Anorexia was first diagnosed in 1994, and when she was 17 years old she was treated as an inpatient By the age of ... events or trauma She also has a history of self-harm, overdosing, burning Page of and lacerating; her last admission to Accident and Emergency was two years ago Her father died of alcohol-related problems ... Nutt D: Management of insomnia: treatments and mechanisms Br J Psychiat 2007, 191:95-197 Sanger D: The pharmacology and mechanisms of action of new generation, non-benzodiazepine hypnotic agents...
  • 4
  • 272
  • 0
Báo cáo y học: " Institutionalizing evidence-based practice: an organizational case study using a model of strategic change" pptx

Báo cáo y học: " Institutionalizing evidence-based practice: an organizational case study using a model of strategic change" pptx

Ngày tải lên : 11/08/2014, 05:21
... 12(4):273-279 Damanpour F: Organizational innovation: a meta-analysis of effects of determinants and moderators Acad Manage J 1991, 34(3):555-590 Oranta O, Routasalo P, Hupli M: Barriers to and facilitators ... scale for receptivity/✰ and non-receptivity/✗, as well as the meaning of each type of symbol and arrow A blank scale, as in the change agenda and its locale, indicates no discernible data regarding ... receptive negative influence of an X positive influence of a Star Change agenda and its locale Key people leading change Simplicity and clarity of goals Managerial clinical relations Cooperative inter-organizational...
  • 19
  • 457
  • 0
báo cáo khoa học: " Institutionalizing evidence-based practice: an organizational case study using a model of strategic change" pdf

báo cáo khoa học: " Institutionalizing evidence-based practice: an organizational case study using a model of strategic change" pdf

Ngày tải lên : 11/08/2014, 16:20
... 12(4):273-279 Damanpour F: Organizational innovation: a meta-analysis of effects of determinants and moderators Acad Manage J 1991, 34(3):555-590 Oranta O, Routasalo P, Hupli M: Barriers to and facilitators ... scale for receptivity/✰ and non-receptivity/✗, as well as the meaning of each type of symbol and arrow A blank scale, as in the change agenda and its locale, indicates no discernible data regarding ... receptive negative influence of an X positive influence of a Star Change agenda and its locale Key people leading change Simplicity and clarity of goals Managerial clinical relations Cooperative inter-organizational...
  • 19
  • 354
  • 0
Báo cáo y học: "Retention of foreign body in the gut can be a sign of congenital obstructive anomaly: a case report" potx

Báo cáo y học: "Retention of foreign body in the gut can be a sign of congenital obstructive anomaly: a case report" potx

Ngày tải lên : 11/08/2014, 21:22
... May 19 Palanivelu C, Rangarajan M, Rajapandian S, Vittal SK, Maheshkumaar GS: Laparoscopic retrieval of 'stubborn' foreign bodies in the foregut: a case report and literature survey Surg Laparosc ... A sign of partial obstruction caused by duodenal anomalies Radiology 1975, 114:683-686 Stanley P, Law BS, Young LW: Down's syndrome, duodenal stenosis/annular pancreas, and a stack of coins Am ... considered abnormal An abdominal CT scan is of great help in diagnosing and detecting the etiology of intestinal obstruction in 73–95% of cases [1012] A CT scan may also be able to demonstrate the foreign...
  • 3
  • 387
  • 0
báo cáo khoa học: " Identification of an extensive gene cluster among a family of PPOs in Trifolium pratense L. (red clover) using a large insert BAC library" ppsx

báo cáo khoa học: " Identification of an extensive gene cluster among a family of PPOs in Trifolium pratense L. (red clover) using a large insert BAC library" ppsx

Ngày tải lên : 12/08/2014, 03:20
... TAACCCTGCTACTAATCCAAGTGCAGAAGAACAAATCAAAATCAACCTTACTTGGATGCATAAACAAATGATCTCCAACAGCAAGACCAATAGACAATTT (701) TAACCCTGCTACTAATCCAAGTGCAGAAGAACAAATCAAAATCAACCTTACTTGGATGCATAAACAAATGATCTCCAACAGCAAGACCAATAGACAATTT ... http://www.biomedcentral.com/1471-2229/9/94 100 (1) ATGATACTAACCAAAATAGCCCTAAAGAACAAGAACAAAAAGCATCACCTAGAAGAAATGTTCTAATAGGTCTAGGAGGACTTTATGGTGCTACCACTTT (1) ATGATACTAACCAAAATAGTCCTAAAGAACAAGAACAAAAATCATCACCAAGAAGAAATGTTCTAATAGGTCTAGGAGGACTTTATGGTGCTACCACTTT ... CCATTTTTACAAATCCAAATTCTTCCCTTTATGACCCTAGAAGAAATCCCTCACATCAACCACCAACAATCGTTGACCTAAACTATAACAAAGCTAATGA (601) CCATTTTTACAAATCCAAATTCTTCCCTTTATGACCCTAGAAGAAATCCCTCACATCAACCACCAACAATCGTTGACCTAAACTATAACAAAGCTAATGA...
  • 11
  • 275
  • 0
Luận Án TS y học: Developing a model of client satisfaction with a rehabilitation continuum of care

Luận Án TS y học: Developing a model of client satisfaction with a rehabilitation continuum of care

Ngày tải lên : 25/07/2015, 18:36
... outcomes of OT intervention and prevention strategies in an interdisciplinary and translational context is a critical component in any model and recommended in the Centennial Vision An explanatory caveat ... time, medical care and the evaluation of healthcare quality were being examined at a physician-patient level of interaction One indicator of the quality of medical care was the restoration of function ... outcomes for facilities and consumers of healthcare (Urden, 2002) Health care satisfaction and outcomes In any medical or healthcare setting, patient satisfaction has become an important quality outcome...
  • 150
  • 351
  • 0
Báo cáo khoa học: "Representing a System of Lexical Types Using Default Unification" pdf

Báo cáo khoa học: "Representing a System of Lexical Types Using Default Unification" pdf

Ngày tải lên : 17/03/2014, 23:20
... Linguistics, 25.2 An earlier version of the paper is available at http://www.csli.stanford.edu/ ,-~aac/papers/yadu.gz Pollard, Carl and Ivan A Sag 1987 InformationBased Syntax and Semantics, CSLI ... Pollard and Sag's strict-trans type: [SUBCAT: ], while the latter works as an intermediate type, where SUBGAT contains at least two arguments, as ... encode the same information as Pollard and Sag's but also to specify more sub-regularities, in a more concise way Such an approach has the advantage of optionally allowing default specifications to...
  • 4
  • 285
  • 0
Báo cáo khoa học: A novel factor XI missense mutation (Val371Ile) in the activation loop is responsible for a case of mild type II factor XI deficiency doc

Báo cáo khoa học: A novel factor XI missense mutation (Val371Ile) in the activation loop is responsible for a case of mild type II factor XI deficiency doc

Ngày tải lên : 23/03/2014, 07:20
... method based on a modied partial thromboplastin time, using FXI-decient plasma as substrate (Hemoliance, Salt Lake City, UT) FXI antigen was measured by an ELISA based on a goat anti-human FXI afnity ... IgG as capture antibody and a goat antihuman FXI peroxidase-conjugated IgG as detecting antibody (Afnity Biological Inc., Hamilton, Ontario, Canada) FXI levels were expressed in both tests as ... and the amount of free paranitroaniline released by FXIa was determined by measuring the change in absorbance at 405 nm in a Benchmark II microplate reader (Bio-Rad Laboratories, Hercules, CA)...
  • 11
  • 563
  • 0
Báo cáo toán học: "A Characterization of Morrey Type Besov and Triebel-Lizorkin Spaces" ppt

Báo cáo toán học: "A Characterization of Morrey Type Besov and Triebel-Lizorkin Spaces" ppt

Ngày tải lên : 06/08/2014, 05:20
... H Arai and T Mizuhara, Morrey spaces on spaces of homogeneous type and estimates for b and the Cauchy-Szeg¨ projection, Math Nachr 175 (1997) o 5–20 G Di Fazioand and M Ragua, Interior estimates ... dz[ψk ,a f (x)]1−r (1 + 2k |x − z|)ar (21) A Characterization of Morrey Type Besov and Triebel-Lizorkin Spaces 377 holds, where N = N − a + n can be taken arbitrarily large Similarly, we can prove ... Function space theory and applications to non-linear PDE, Trans Amer Math Soc 355 (2003) 1297–1364 A Mazzucato, Decomposition of Besov-Morrey spaces, in Harmonic Analysis at Mount Holyoke, AMS Series...
  • 11
  • 311
  • 0
LOWER BOUNDS ON THE KOBAYASHI METRIC NEAR A POINT OF INFINITE TYPE

LOWER BOUNDS ON THE KOBAYASHI METRIC NEAR A POINT OF INFINITE TYPE

Ngày tải lên : 26/10/2015, 14:04
... Ian Graham Boundary behavior of the Carath´eodory and Kobayashi metrics on strongly pseudoconvex domains in C n with smooth boundary Trans Amer Math Soc., 207:219–240, 1975 G M Henkin An analytic ... of the Kobayashi metric is an important tool in the function theory of several complex variables and has been studied by many authors In the following, we briefly review some significant, classical ... point of finite type Ann of Math (2), 136(2):339–360, 1992 [Ran78] R Michael Range The Carath´eodory metric and holomorphic maps on a class of weakly pseudoconvex domains Pacific J Math., 78(1):173–189,...
  • 15
  • 382
  • 0
báo cáo khoa học: " Can one puff really make an adolescent addicted to nicotine? A critical review of the literature" potx

báo cáo khoa học: " Can one puff really make an adolescent addicted to nicotine? A critical review of the literature" potx

Ngày tải lên : 11/08/2014, 18:20
... unbearable automaticity of being American Psychologist 1999, 54:462-479 42 American Psychiatric Association: Diagnostic and statistical manual of mental disorders: DSM-IV-TR Washington, DC: American ... effortless exercise of free will” is untenable Many human behaviors are habitual and automatic rather than intentional and willful, so that both performing and discontinuing them is rarely an effortless ... they are generally downplayed and not affect the decisiveness of the conclusions Interpretation of the findings is often biased and obvious caveats and alternative explanations for the data are often...
  • 9
  • 387
  • 0
Intelligent Software Agents on the Internet: an inventory of currently offered functionality in the information society & a prediction of (near-)future developments

Intelligent Software Agents on the Internet: an inventory of currently offered functionality in the information society & a prediction of (near-)future developments

Ngày tải lên : 08/10/2012, 15:22
... Software agents are a rapidly developing area of research However, to many it is unclear what agents are and what they can (and maybe cannot) In the first part, this thesis will provide an overview ... program (i.e an agent) can faster or better than a human can Human intermediaries will handle the (very) complicated problems, and will divide these tasks into sub-tasks that can (but not necessarily ... ideas and observations - an essential part of the intellectual capital of a company - will be available for everyone And neatly integrated with authoritative external sources"; Internal Databases:...
  • 100
  • 811
  • 3