an example of a validation protocol for a chromatographic method
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
Ngày tải lên :
23/03/2014, 13:20
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...
- 11
- 679
- 0
Báo cáo y học: "Is obesity a risk factor for low back pain? An example of using the evidence to answer a clinical question" ppsx
Ngày tải lên :
13/08/2014, 13:22
... basic research appeared to conclude what was already intuitively thought about low back pain and increased weight Body mass index Before an in-depth discussion of low back pain and obesity can ... The relation of spinal x-ray to low back pain and physical activity among 60 year old men and women Spine 1985, 10:445-451 Lean ME, Han TS, Seidell JC: Impairment of health and quality of life ... degeneration in an urban population Ann Rheum Dis 1958, 17:388-397 Magora A, Schwartz A: Relation between the low back pain syndrome and x-ray findings I: Degenerative osteoarthritis Scand J Rehabil...
- 6
- 402
- 0
A study on an example of non-verbal interaction between the presenter and audience for English majored students at the School of Foreign Language
Ngày tải lên :
19/03/2015, 10:37
... 4, Al-Issa, A (2006b) Language problems facing Omani learners of English ORTESOL, 24, pp.19-26 Al-Issa, A (200 7a) English language teaching at the College of Law-Muscat, Sultanate of Oman: Analyzing ... scientifically and objectively than other forms of research Questionnaire is easy to analyze Data entry and tabulation for nearly all surveys can be easily done with many computer software packages ... has the capacity for great variety and advantages Varying vocal qualities adds interest and meaning to the messagesof the presenters The vocal characteristics of rate, volume, clarity, etc All...
- 50
- 454
- 2
Báo cáo toán học: "An extension of a criterion for unimodality" pps
Ngày tải lên :
07/08/2014, 06:22
... Log-concave and unimodal sequences in Algebra, Combinatorics and Geometry: an update Contemporary Mathematics, 178, 71-84, 1994 [4] Stanley, R.: Log-concave and unimodal sequences in algebra, combinatorics ... if a j sequence is log concave then it is unimodal [5] A sufficient condition for log concavity of a polynomial is given by the location of its zeros: if all the zeros of a polynomial are real and ... combinatorics and geometry Graph theory and its applications: East and West (Jinan, 1986), 500-535, Ann New York Acad Sci., 576, New York, 1989 [5] Wilf, H.S.: generatingfunctionology Academic Press,...
- 7
- 331
- 0
Báo cáo y học: "Ultrasound guided injection of dexamethasone versus placebo for treatment of plantar fasciitis: protocol for a randomised controlled trial" potx
Ngày tải lên :
10/08/2014, 21:24
... trial as regional anaesthesia will be performed prior to plantar fascia injections Plantar fascia thickening Fusiform thickening of the plantar fascia is a well established feature of plantar fasciitis ... proximal plantar fascia To confirm the diagnosis of plantar fasciitis, the dorso-plantar thickness of the plantar fascia will be measured by ultrasound at a standard location where the fascia crosses ... the anterior aspect of the inferior calcaneal border Participants will be required to have a plantar fascia thickness value of 4.0 mm or greater [28] Finally, participants McMillan et al Journal...
- 8
- 352
- 0
Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country pdf
Ngày tải lên :
11/08/2014, 05:21
... comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic member (in comparison to an assistant ... Sex (male/female) Associate professor (in comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic ... countries of the WHO Eastern Mediterranean Region Egypt, Islamic Republic of Iran, Morocco, Pakistan and Sudan World Health Organization,Regional Office for the Eastern Mediterranean; 2004:76-80...
- 8
- 341
- 0
báo cáo khoa học: " Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country" pot
Ngày tải lên :
11/08/2014, 16:21
... comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic member (in comparison to an assistant ... Sex (male/female) Associate professor (in comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic ... countries of the WHO Eastern Mediterranean Region Egypt, Islamic Republic of Iran, Morocco, Pakistan and Sudan World Health Organization,Regional Office for the Eastern Mediterranean; 2004:76-80...
- 8
- 315
- 0
Báo cáo y học: "implementation and evaluation of the SPRINT protocol for tight glycaemic control in critically ill patients: a clinical practice change" ppsx
Ngày tải lên :
13/08/2014, 10:20
... collection and the analysis and interpretation of the data DL provided statistical assistance CH provided mathematical assistance during the development of SPRINT All authors read and approved the final ... performance metrics on a perpatient basis can give important information on the variation of protocol performance between patients Conclusion SPRINT was implemented as a clinical practice change and ... collection and the analysis and interpretation of the data, and helped draft the manuscript T Lonergan and MW helped conceive and develop the SPRINT protocol XWW, JL, and T Lotz assisted in data collection...
- 15
- 250
- 0
Báo cáo y học: "Pre-hospital intubation by anaesthesiologists in patients with severe trauma: an audit of a Norwegian helicopter emergency medical service"
Ngày tải lên :
25/10/2012, 09:56
... safety) Materials and methods Stavanger HEMS The Stavanger HEMS is part of the national HEMS system of Norway, and its primary areas of operation are the mixed urban and rural districts of Rogaland ... the data, performed the statistical analysis and drafted the manuscript HML and ES helped design the study and draft and review the manuscript All authors have read and approved the final manuscript ... research fellowship from the Norwegian Air Ambulance Foundation Author details Department of Research and Development, Norwegian Air Ambulance Foundation, Drøbak, Norway 2Department of Anaesthesiology...
- 6
- 611
- 0
Tài liệu An Evaluation of A Participatory Research Approach in Rainfed Lowland Area of Vinh Trach Village, B pptx
Ngày tải lên :
16/01/2014, 21:20
... objective of the FARM Program is to enhance the capabilities of GOs and NGOs, to build local capacity of resource poor farmers for sustainable use and management of agricultural and natural resources ... team-work and also multiple perspectives It gives the appreciative character of social organization of innovation In fact that SWG acts to bring a collaborative and linking among important actors ... research approaches to support the small-scale household farming in utilizing and managing of agricultural and natural resources reasonably Central elements in this participatory research are team-work...
- 8
- 492
- 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
Ngày tải lên :
18/02/2014, 17:20
... (BD Pharmingen, Franklin Lakes, NJ, USA), anti-Lyve-1 (R&D, Minneapolis, MN, USA), anti-Prox-1 (Acris Antibodies, Hiddenhausen, Germany), and anti-SV40 T Ag (Santa Cruz Biotechnology, Santa Cruz, ... 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products were cloned into the EcoRV site of ... SV40T Ag and the 3¢ portion of the tsA58T Ag cDNA carrying the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R,...
- 11
- 873
- 0
báo cáo hóa học: " Development and validation of the Brazilian version of the Attitudes to Aging Questionnaire (AAQ): An example of merging classical psychometric theory and the Rasch measurement model" pptx
Ngày tải lên :
18/06/2014, 22:20
... reliability analyses Exploratory and Confirmatory Factor analysis were performed to assess whether the Brazilian data fit the international pooled model Finally, an IRT approach, in particular, that of ... increase Brazilian scale fit and performance These potential alterations should not promote crucial modifications in the scale format, since they can be made during the statistical analysis phase and ... statistical analysis and drafted the manuscript; MPF participated in the study design, statistical analysis and helped to draft the manuscript; CMT participated in the study design and data collection;...
- 10
- 871
- 0
báo cáo hóa học:" Development and validation of the Brazilian version of the Attitudes to Aging Questionnaire (AAQ): An example of merging classical psychometric theory and the Rasch measurement model" docx
Ngày tải lên :
20/06/2014, 16:20
... reliability analyses Exploratory and Confirmatory Factor analysis were performed to assess whether the Brazilian data fit the international pooled model Finally, an IRT approach, in particular, that of ... increase Brazilian scale fit and performance These potential alterations should not promote crucial modifications in the scale format, since they can be made during the statistical analysis phase and ... statistical analysis and drafted the manuscript; MPF participated in the study design, statistical analysis and helped to draft the manuscript; CMT participated in the study design and data collection;...
- 10
- 737
- 0
Báo cáo hóa học: " Strong convergence of a hybrid method for monotone variational inequalities and fixed point problems" ppt
Ngày tải lên :
20/06/2014, 22:20
... inequalities Carpathian J Math 24, 139–148 (2008) He, BS, Yang, ZH, Yuan, XM: An approximate proximal-extragradient type method for monotone variational inequalities J Math Anal Appl 300, 362–374 ... 833, Taiwan 3Department of Applied Mathematics, Chung Yuan Christian University, Chung Li 32023, Taiwan 4Center for General Education, Kaohsiung Medical University, Kaohsiung 807, Taiwan Authors’ ... contributions All authors participated in the design of the study and performed the converegnce analysis All authors read and approved the final manuscript Competing interests The authors declare that they...
- 10
- 425
- 0
An autobiography of a story book pptx
Ngày tải lên :
22/07/2014, 03:21
... would then be able to lead a more comfortable life Perhaps I can invent cars that are operated by robots or a computer that thinks like a human My parents think highly of my ambition and are very ... understand the answer In class, I always make sure that I perform each science experiment properly When in doubt, I consult my teachers As a scientist, I would be able to invent new things for mankind ... One day a few girls entered the shop They laughed and joked among themselves They were browsing through the books and one of them picked me up She was attracted to me and bought me immediately...
- 6
- 385
- 0
An autobiography of a pen doc
Ngày tải lên :
22/07/2014, 03:21
... skins and then crawled out of the old ones We then turned into large grey, yellow and orange striped caterpillars My next stage was the pupa stage I crawled under a leaf of the plant and spun a pod ... leaf of a milkweed plant After several days we hatched into tiny black and white larvae At this stage we were called tiny caterpillars We moved about the plant and fed on its fleshy green leaves ... I was on display for only a short period A grand old lady came to the store one day She was looking for a gift She bought me and presented me to a girl named Mary Mary is a student and used...
- 6
- 440
- 0
An autobiography of a dancing doll ppsx
Ngày tải lên :
22/07/2014, 03:21
... lady came to the store She looked around the place and her eyes felon me She looked at me in admiration She at once bought me I was given as a birthday present to her only daughter Pam I was ... let her friends handle me When Pam was not attending to me, one of her friends picked me up Pam was furious and tried to pull me away form her friend In the tussle they accidentally ripped my pretty ... dress Pam cried and her mother consoled her by promising to buy a new doll I was given away to the servant’s daughter, who accepted me with great delight She skillfully mended the tear in my...
- 4
- 233
- 0
báo cáo khoa học: " Improving eye care for veterans with diabetes: An example of using the QUERI steps to move from evidence to implementation: QUERI Series" ppsx
Ngày tải lên :
11/08/2014, 16:21
... conditions; and 5) advancing clinically-meaningful quality/performance measurement as an important tool for promoting and assessing quality improvement interventions Examples of work by DM-QUERI that address ... performance measure, which still emphasized annual visits at the time of the project Specifically, the research team was encouraging changes based on the evidence and an antic- Page of 11 (page ... existing Health Plan Employer Data and Information Set (HEDIS®) [30] and VA performance measures for diabetes eye care, and 2) an implementation project to promote close follow-up of high-risk patients...
- 11
- 443
- 0
Structuring an advertising business in Vietnam (an example of FPT media - the corporation for financing and promoting technology)
Ngày tải lên :
26/03/2015, 08:55
... important Designing a structure that fit a company’s need is a large challenge Each structure has advantages and disadvantages, and managers have to be ready and willing to redesign the organization ... the authority possessed by managers at each level decrease, as does their area of responsibility A flat of organization has fewer managers and hierarchical levels than a tall organization, so a ... a flat organization’s managers possess relatively more authority and responsibility than a tall organization’s manager Motivation in an organization with a flat structure may be stronger than...
- 104
- 1.5K
- 2
An application of a discourse-based approach in teaching English skill at Thanh Hoa Vocational School of Commerce – Tourism = Ứng dụng phương pháp tiếp cận dựa
Ngày tải lên :
28/03/2015, 09:26
... learners are able to understand the formal structures and logical meaning of the material they read with an average degree of difficulty and within general and familiar topics, but cannot understand ... and its social situation British discourse analysis was mainly influenced by M .A. K Halliday‘s functional approach to language Halliday‘s framework emphasized the social function of language and ... language (i.e., cultural and 10 ideological meanings) and lower-order forms of language that contribute to patterning the meaning In layman‘s terms reader cannot neglect the role of individual...
- 66
- 704
- 0