... rate was maintained at 1.8 lpm, and varied for few of the tests A 20-lpm flow of compressed air was supplied in a radial direction to the quenching ring for cooling The entrained air diluted ... the point where the absorption was 30% of the maximum, corresponding to where 50% of the photons were absorbed This approach was used because of the difficulty in finding the linear region of the ... was maintained at a temperature of 98°C The precursor delivery tube was maintained at a temperature of 210°C by a heating tape This avoided the condensation of the precursor TTIP vapor in the...
... by binding to a binding site other than BL In addition, changes in the conformation of BL caused by this binding of proton result in decreases in the number of BL The conformation change of BL ... varying pH However, because copper toxicity should depend on the integration ofcopper accumulation until each exposure duration, decreases in the internalization flux ofcopper should result in ... for the toxicity model, indicating that increases in proton concentration cause decreases incopper toxicity though proton is not a competitive cation with copper binding onto BL Heijerick et...
... (b hairpin) Asp90 (b hairpin) Asp90 (b hairpin) Ile35 (b 3) V) and between HN of Asp92 and side chain carboxylic group of Asp90 are well conserved in all conformers of the present family and in ... dimeric form The dimeric nature of the protein was taken into account by connecting the amino acid sequence of the two subunits with a chain of linkers composed of atoms with a null Van der Waals ... experiment In each subunit the metal ions were included by allowing copper to bind to Ne2 of His48 and His120 and to Nd 1of His46, and zinc to Nd1 of His63, His71, and His80 and to Od1 of Asp83...
... of the expenditures Clusters of programs are indicated in the schedule by light gray shading Schedule of Findings and Questioned Costs The Schedule of Findings and Questioned Costs consists of ... purpose of expressing our opinion on the financial statements, but not for the purpose of expressing an opinion on the effectiveness of Metro’s internal control over financial reporting Accordingly, ... review of accounting entries underway, Metro OMB will begin revising and updating the year end training policies to reflect the change in accounting, budgeting and grant reporting and incorporate...
... N-terminus and other domains of the ATPase Indeed, in vitro studies of the purified N-terminus and catalytic loop of the Wilson ATPase have shown that these two domains interact in the absence ofcopper ... domain–domain interactions are relieved by binding of the metal to the N-terminus of the ATPase To further study the role of the Ccc2 N-terminus in the overall function of the ATPase in vivo, we engineered ... inhibitory domain–domain interactions in Ccc2 is to delete the N-terminus, as in DMBDCcc2 In vitro, DMBDCcc2 is active and phosphorylatable by ATP in the presence ofcopperCopper binding at the...
... formed in yeast which is likely to contain only minor inclusions of peroxisomal matrix proteins A C Vps1p and Dnm1p: two dynamin-like proteins involved in fission of peroxisomes and Woronin bodies ... was conducted, in the presence or absence of detergent Examination of a wild-type PNS revealed increasing amounts of peroxisomal marker proteins in the pellet fractions upon increasing centrifugation ... components of the peroxisomal fission machinery by examining the fate of HEX1 in a vps1Ddnm1D double-deletion strain The results are discussed in terms of a mechanism for the formation of Woronin bodies...
... initiates repair of single- nucleotide gaps, PNK is required for the initiation of repair of 3¢-phosphatecontaining SSBs, and APE1 initiates repair of 3¢-phosphoglycolate-containing SSBs Removal of these ... binding ⁄ cross-linking of the remaining proteins to the substrate DNA, containing SSBs with various 3¢-end modifications, we investigated which proteins initiate recognition and repair of such lesions ... DNA–protein cross-linking protocol aimed at revealing the engagement of BER proteins during repair of damaged DNA [15] In brief, this protocol uses oligonucleotides containing a 3¢-biotinylated...
... 5¢)3¢ orientation VK1.link VK2.link VK3.link VK4.link VK5.link VK6.link VL1.link VL2.link VL3b.link VL3a.link VL4.link VL5.link VL6.link JH1-2.link JH3.link JH4-5.link JH6.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC ... residue 101 in the CDR3 (Val101Phe) of the heavy chain might also be important for binding to the toxin The change of Val to Phe may result in a better interaction in terms of an increased contact ... a consequence of directed evolution [36] or shortening of the linker peptide (unpublished results), resulted in an improvement in the stability of the single chain The diabodies of evolved clones...
... results are 1.7 higher in terms of jobs, and 1.5 times higher in terms of labor income The difference in local input data as well as choosing different industrial sectors can explain these differences ... vendors are of interest To incorporate this information into IMPLAN, it is necessary to assign a detailed industry code to each transaction indicating the nature of the good or service being purchased ... total cost of developing the site for mining and construction of the processing facilities will be $913 million The Project will employ an average of 443 workers annually during the main production...
... of tender points with value >0 at randomization; the number is missing if any of 18 tender points is missing b Baseline = Last available pain scores before taking study medication up to and including ... properties of a single- item Sleep Quality numeric rating scale completed by FM patients daily in two clinical trials During the baseline phase, study patients had to have an average daily diary pain ... similarly defined sleep quality as tiredness on waking and throughout the day, feeling rested and restored on waking, and the number of awakenings experienced in the night [10] Single- item sleep...
... deficits to the shrinkage of prefrontal brain areas in old age, since those areas are related to executive functions (e.g., processing of multi-tasking) Of note, it was recently shown in healthy older ... http://www.jneuroengrehab.com/content/7/1/56 function in terms of an increase in sensitivity of this mechanoreceptor [45] Increased muscle spindle sensitivity may represent a fatigue-induced compensatory mechanism to maintain function ... risk of sustaining a fall when encountering a balance threatening situation in a fatigued state The finding that young and older adults showed similar fatigue-induced responses when compensating...
... characterization, and kinetic study of vertical single- crystalline CuO nanowires on Si substrates Shao-Liang Cheng*1 and Ming-Feng Chen1 Department of Chemical and Materials Engineering, National Central ... orientations In addition, pronounced streaking was observed in the SAED patterns, indicating the presence of some planar defects in these CuO nanowires As can be seen in the HRTEM observation shown in ... insets show the corresponding indexed SAED patterns (d) TEM image of an individual CuO nanowire The inset shows the corresponding FFT-filtered lattice images from the outlined region marked in...
... directly in VHDL or using the Xilinx System Generator toolchain for Matlab Compared to the use of C language in OpenAirInterface, the use of VHDL is more cumbersome and time consuming Also, the Xilinx ... general overview of OpenAirInterface, in this paper we present OpenAirMesh—a specification of wireless mesh network and its implementation on the OpenAirInterface platform OpenAirMesh exemplifies ... extension of the Linux operating system The use of an open-source software modem has several advantages Firstly, the same code can be initially debugged and tuned in simulation before using it in the...
... expected, in favor of the formation of more ultrafine nanoparticles Along this line, the use of stronger reducing agent NaBH4 played an important role as well in the controlled synthesis of ultrafine copper ... accelerating voltage of 100 kV TEM samples were prepared by placing a drop of a dilute dispersion of Cu nanoparticles on the surface of a 400-mesh copper grid backed with Formvar and were dried in ... ofCopper Nanoparticles Synthesis of ultrafine copper nanoparticles in organic solvent was typically processed as follows A certain amount of poly(N-vinylpyrrolidone) (PVP, MW = 55,000), acting...
... example to investigate the in uences of H on the adsorption of metal on the Si(111)-7 surface using first-principles calculations H is the main surfactant during the heteroepitaxy of the metals ... surfaces and interfaces play a critical role in providing a nanoscopic understanding of the chemical bonding in these systems in the determination of the atomic geometry and electronic structure ... study the in uences of H on the adsorption of Ag on the Si(111)7 surface using the Vienna ab initio simulation package (VASP) [31] Ab initio density functional calculations of surfaces and interfaces...
... further investigated with SAED The SAED pattern (Fig 3c) taken from a single nanowire, indicates that the SnS nanowires are a good single crystalline The HRTEM image of a single SnS Fig TEM images of ... diameters of 50 ± nm and the interpore distance is about 30 nm In addition, the varied diameters and lengths of nanopores can be obtained by adjusting the varied acid, anodizing time, and anodizing ... image, the lattice fringes of the SnS are clear and uniform, and additionally it confirmed that these single crystalline SnS nanowires are of high quality The measured spacing of the crystallographic...
... This mixture was injected under vigorous stirring and an argon flow into another flask (2) containing a hot (170 °C or 205 °C) solution of ml of degassed oleylamine and 0.2 g of tetradecylphosphonic ... obtained due to insolubility of SnS NCs in the short chain ketone and then separated by centrifugation The retrieved flocculate precipitate containing the desired SnS NCs was redissolved in chloroform ... extrapolation of the linear region of the plot of (ahv)1/2 against photon energy (hv) as shown in Fig 4(c) Clearly, the absorption corresponds to an indirect allowed transition with an energy gap of 1.6...
... This mixture was injected under vigorous stirring and an argon flow into another flask (2) containing a hot (170 °C or 205 °C) solution of ml of degassed oleylamine and 0.2 g of tetradecylphosphonic ... obtained due to insolubility of SnS NCs in the short chain ketone and then separated by centrifugation The retrieved flocculate precipitate containing the desired SnS NCs was redissolved in chloroform ... extrapolation of the linear region of the plot of (ahv)1/2 against photon energy (hv) as shown in Fig 4(c) Clearly, the absorption corresponds to an indirect allowed transition with an energy gap of 1.6...
... proof of the theorem of v., § 11 69 THE INTEGRATION OF FUNCTIONS OF A SINGLE VARIABLE I Introduction The problem considered in the following pages is what is sometimes called the problem of ‘indefinite ... The Integration of Functions of a Single Variable THE INTEGRATION OF FUNCTIONS OF A SINGLE VARIABLE BY G H HARDY SECOND EDITION CAMBRIDGE AT THE UNIVERSITY PRESS 1966 PUBLISHED BY THE SYNDICS OF ... of integration 15 Particular problems of integration 17 The limitations of the methods of integration 20 Conclusion 22 V The integration of algebraical functions Algebraical functions 22 22 Integration...