amp x03b1 as a mediator of endothelial cell activation in preeclampsia

Báo cáo khoa học: Apoptosis and autophagy: BIM as a mediator of tumour cell death in response to oncogene-targeted therapeutics pptx

Báo cáo khoa học: Apoptosis and autophagy: BIM as a mediator of tumour cell death in response to oncogene-targeted therapeutics pptx

Ngày tải lên : 16/03/2014, 00:20
... a potent inhibitor of mitogen-activated protein kinase ⁄ extracellular signal-regulated kinase kinase ⁄ kinases: mechanism of action in vivo, pharmacokinetic ⁄ pharmacodynamic relationship, and ... signalregulated kinase ⁄ (ERK1 ⁄ 2) and protein kinase B (PKB) pathways that act downstream of oncogenic protein kinases [10,11] It is increasingly apparent that BIM as a mediator of tumour cell ... tyrosine kinase activates several signalling pathways, including the ERK1 ⁄ pathway, the PKB pathway and the Janus kinase ⁄ signal transducer and activator of transcription (JAK-STAT) pathway,...
  • 13
  • 453
  • 0
báo cáo hóa học: " Physical activity as a mediator of the impact of chronic conditions on quality of life in older adults" pptx

báo cáo hóa học: " Physical activity as a mediator of the impact of chronic conditions on quality of life in older adults" pptx

Ngày tải lên : 18/06/2014, 22:20
... based on full information maximum likelihood estimation (FIML) (available in the Mplus 4.2 [30] software package) by using all available data to assess whether the estimates may have been biased ... life in older adults The data were collected by Statistics Canada under the authority of the Statistics Act Access to the data was granted by Statistics Canada based on a peer-reviewed proposal ... 2.0) in the chronic condition subsamples (Table 4) Increased physical activity was also associated with a relative increase in emotional wellbeing and relatively fewer cognitive problems and dexterity...
  • 11
  • 619
  • 0
báo cáo khoa học: "The transplant iron score as a predictor of stem cell transplant survival" pptx

báo cáo khoa học: "The transplant iron score as a predictor of stem cell transplant survival" pptx

Ngày tải lên : 10/08/2014, 22:20
... groupings, a univariate relative risk of death was calculated for each iron parameter using hazard regression analysis Survival time was measured from the date of transplant to the date of death or last ... American Laboratory Products Company, Windham, NH The kit shows no cross-reactivity against albumin, lysozyme, alpha-1 antitrypsin and other acute phase proteins Values for aspartate transaminase ... were measured using a commercially available sandwich enzyme immunoassay (EIA) (Ramco Laboratories, Inc Stafford, TX) C-reactive protein was measured using an enzyme-linked immunosorbent assay (high...
  • 9
  • 320
  • 0
Báo cáo y học: "The efficacy of Link N as a mediator of repair in a rabbit model of intervertebral disc degeneration" ppt

Báo cáo y học: "The efficacy of Link N as a mediator of repair in a rabbit model of intervertebral disc degeneration" ppt

Ngày tải lên : 12/08/2014, 17:22
... Aggrecan Forward: GAGGTCGTGGTGAAAGGTGT Annealing temperature (°C) 60 Reverse: GTGTGGATGGGGTACCTGAC COL 1A1 Forward: AGGGCCAAGACGAAGACATC 62 Reverse: AGATCACGTCATCGCACAACA RNA extraction and gene ... biochemical analysis and statistical analysis, and was involved in preparation of the manuscript RP, TY and AH performed data acquisition and statistical analysis PJR participated in the design of ... Reverse: GGAGAACATATGGTCCCAACGT GAPDH Forward: ACTCTGGCAAAGTGGATG 60 Reverse: TCCTGGAAGATGGTGATG expression of the Link N-treated discs was normalized to saline-treated discs Biochemical analysis...
  • 9
  • 402
  • 0
Tài liệu Báo cáo Y học: Use of site-specific recombination as a probe of nucleoprotein complex formation in chromatin Micha Schwikardi and Peter Droge ¨ potx

Tài liệu Báo cáo Y học: Use of site-specific recombination as a probe of nucleoprotein complex formation in chromatin Micha Schwikardi and Peter Droge ¨ potx

Ngày tải lên : 22/02/2014, 07:20
... for a phage l integrase mutant was set as 100% In each case, data were collected from six separate transfection assays, each employing two wells containing about  105 cells (C) Normalized b-Gal ... recombination on episomal and on genomic targets, we have shown that the dynamic nature of chromatin renders a site of at least 34 bp in general reactive for recombination However, the assembly of ... histone deacetylases or topoisomerases Histone modifications such as acetylation and phosphorylation play important roles in the regulation of chromatin structure In particular acetylation of the...
  • 7
  • 472
  • 0
Báo cáo khoa học: "Alteration of nitrergic neuromuscular transmission as a result of acute experimental colitis in rat" pot

Báo cáo khoa học: "Alteration of nitrergic neuromuscular transmission as a result of acute experimental colitis in rat" pot

Ngày tải lên : 07/08/2014, 18:21
... esahP gnilpmas fo yad emas eht no deyassa dna ,C°02− ni derots erew selpmas amsalp ehT amsalp eht etarapes ot g × 005,1 yletamixorppa ta nim 51 rof degufirtnec saw elpmas hcae ,noitcelloc fo nim ... dohtem yassa lacigoloiborcim a gnisu denimreted erew snoitartnecnoc emipefec amsalp ehT o dohtem lacitylanA esahp ni sa demrofrep erew serudecorp gnilpmas eht dna esod emas eht ta ylralucsumartni ... ehT )ASU ,SSPS ;0.2 noisrev( tatsamgiS ,margorp lacitsitats eht gnisu dezylana saw atad eht llA )deliat-owt( tset deriap a gnisu derapmoc erew noitcefni eht retfa dna erofeb deniatbo seulav citenikocamrahp...
  • 5
  • 205
  • 0
Báo cáo y học: "Serum cystatin C concentration as a marker of acute renal dysfunction in critically ill patients" doc

Báo cáo y học: "Serum cystatin C concentration as a marker of acute renal dysfunction in critically ill patients" doc

Ngày tải lên : 12/08/2014, 20:21
... Botey A, Alvarez L, Poch E, Quintó Ll, Saurina A, Vera M, Piera C, Darnell A: Serum cystanin C as a new marker for noninvasive estimation of glomerular filtration rate and as a marker for early ... creatinine and serum cystatin C as markers of GFR in unstable, critically ill patients Our data indicate that serum cystatin C is a good real-time marker of GFR in such patients If this finding ... cystatin C and serum creatinine for identifying renal dysfunction was evaluated using receiver operating characteristic curve analysis, and the data are expressed as area under the curve (AUC;...
  • 5
  • 224
  • 0
Báo cáo y học: "Plasma DNA concentration as a predictor of mortality and sepsis in critically ill patients" pptx

Báo cáo y học: "Plasma DNA concentration as a predictor of mortality and sepsis in critically ill patients" pptx

Ngày tải lên : 12/08/2014, 23:23
... this was an observational study looking at plasma DNA, a new variable measured from blood samples that were taken as part of standard clinical practice All blood samples were taken from indwelling ... differentiate between cerebral infarction and haemorrhage, suggesting that a wide range of insults may increase levels of circulating DNA It appears that circulating DNA in patients with cancer is almost ... correlation was found between plasma DNA and C-reactive protein, N Terminal-brain natriuretic peptide or procalcitonin Plasma DNA was significantly higher in patients who died in intensive care...
  • 7
  • 280
  • 0
Báo cáo y học: "Socioeconomic status (SES) as a determinant of adherence to treatment in HIV infected patients: a systematic review of the literature" docx

Báo cáo y học: "Socioeconomic status (SES) as a determinant of adherence to treatment in HIV infected patients: a systematic review of the literature" docx

Ngày tải lên : 13/08/2014, 06:20
... medication: HAART = highly active antiretroviral treatment, ZDV = zidovudine, dT4 = stavudine, DLV = delaviridine, IDV = indinavir, 3TC = lamivudine HAART HAART HAART HAART HAART, mainly HAART Antiretroviral ... partial data regarding the association of such SES components, and adherence to antiretroviral treatment, where – and if – such an association was assessed Occupation was only assessed in terms of ... the measure of adherence, the overall adherence and findings regarding the association between major determinants of SES and adherence In this study we assessed three parameters as major factors...
  • 12
  • 319
  • 0
Báo cáo y học: "Evaluating dosage compensation as a cause of duplicate gene retention in Paramecium tetraurelia" pot

Báo cáo y học: "Evaluating dosage compensation as a cause of duplicate gene retention in Paramecium tetraurelia" pot

Ngày tải lên : 14/08/2014, 07:21
... This means that upregulation of individual enzymes can increase or decrease the flux capacity of the pathway and by different amounts Hence, if only certain proteins increase the performance of the ... mutation rate) as a modulator of the strength of selection has been implicated as an important switch between subfunctionalization as a purely neutral process and neofunctionalization or, potentially, ... been evaluated to show that it has the same potential to retain duplicate genes in such high numbers as dosage compensation appears to be able to Eventually, quantitative models characterizing these...
  • 4
  • 288
  • 0
top-antitop cross section measurement as a function of the jet multiplicity in the final state and beyond the standard model top-antitop resonances search at the atlas detector at cern

top-antitop cross section measurement as a function of the jet multiplicity in the final state and beyond the standard model top-antitop resonances search at the atlas detector at cern

Ngày tải lên : 22/12/2014, 22:04
... resonance decaying in a top-antitop pair, using ATLAS data at center -of- mass √ energy of s = TeV The latter analysis is repeated for ATLAS data col√ lected with s = TeV Performance studies of b-tagging ... by a Lagrangian density that can be separated into a gauge term, a matter term, a Yukawa term and a Higgs term [30]: LSM = LMatter + LGauge + LYukawa + LHiggs The matter Lagrangian contains ... smaller than any other particle in the Standard Model They are assumed massless here though, since their mass is much smaller than what can be experimentally verified in the ATLAS detector (Chapter...
  • 251
  • 712
  • 0
A study on intonation as a means of conveying deontic modality in English

A study on intonation as a means of conveying deontic modality in English

Ngày tải lên : 10/08/2015, 19:47
... has already prevented the from getting the goals of communication As a learner and a teacher of English as a foreign language the writer has realized the importance of researching intonation as ... (2005) Indeed, learning to express and interpret modality is very difficult, particularly for learners of English as a foreign language The learners failure in the understanding of the modal meanings ... English as a means of conveying those two semantic features finding mistakes commonly made by Vietnamese learners in using Intonation as a means of conveying deontic modality offering some suggestions...
  • 4
  • 523
  • 2
Suitability of insulin like growth factor 1 (IGF1) as a measure of relative growth rates in lingcod

Suitability of insulin like growth factor 1 (IGF1) as a measure of relative growth rates in lingcod

Ngày tải lên : 04/09/2015, 17:15
... Lates calcarifer antibody and recombinant salmon IGF1 The assay was validated for lingcod by running a series of plasma dilutions and assessing parallelism of the lingcod plasma by comparison ... may occur as a result of increases or decreases in the body size or density of fish in managed areas Measurements of vital rates, such as body growth, provide a necessary link between pattern and ... that spatial patterns of IGF1 and traditional biological measurements are different In our data, it appears that traditional measurements explain more of the variation between management status...
  • 12
  • 428
  • 0
Báo cáo khoa học: Intermittent hypoxia is a key regulator of cancer cell and endothelial cell interplay in tumours pot

Báo cáo khoa học: Intermittent hypoxia is a key regulator of cancer cell and endothelial cell interplay in tumours pot

Ngày tải lên : 30/03/2014, 04:20
... that lead to extracellular matrix degradation (matrix metalloproteases) [75–78] In addition, NF-jB activation was reported as an early event in malignant transformation in vitro [79], and continuous ... hypoxia against radiotherapy on endothelial cells was shown to be HIF-1-dependent Indeed, a decrease in endothelial cell survival after a low level of irradiation (2 Gy) on cells previously incubated ... Blockade of nuclear factor-kappaB signaling inhibits angiogenesis and tumorigenicity of human ovarian cancer cells by suppressing expression of vascular endothelial growth factor and interleukin...
  • 12
  • 390
  • 0
Báo cáo y học: " Paraneoplastic limbic encephalitis as a cause of new onset of seizures in a patient with non-small cell lung carcinoma: a case report" potx

Báo cáo y học: " Paraneoplastic limbic encephalitis as a cause of new onset of seizures in a patient with non-small cell lung carcinoma: a case report" potx

Ngày tải lên : 11/08/2014, 21:22
... in SCLC patients are anti-amphiphysin and anti-CV2 antibodies All of the aforementioned antibodies are 'well characterized' paraneoplastic antibodies b) CSF analysis assists in making the diagnosis ... neurological syndromes, have been described as 'well characterized' paraneoplastic antibodies [2] PEM is characterized pathologically by neuronal loss and inflammatory infiltrates in particular areas of ... undifferentiated large cell lung carcinoma was diagnosed in a 64-year-old Greek man He was a smoker with a smoking history of 60 pack-years Twenty-two years earlier, he had been diagnosed with a seminoma...
  • 5
  • 259
  • 0
Báo cáo y học: "Ku protein as a potential human T-cell leukemia virus type 1 (HTLV-1) Tax target in clastogenic chromosomal instability of mammalian cells" ppt

Báo cáo y học: "Ku protein as a potential human T-cell leukemia virus type 1 (HTLV-1) Tax target in clastogenic chromosomal instability of mammalian cells" ppt

Ngày tải lên : 13/08/2014, 09:21
... that in the presence of the Tax (B) the incorporation signals are far greater than those in the absence of Tax (A) Note that many MN are seen to contain in situ incorporation signals Page of ... self-phosphorylates to inactivate the holokinase complex and then dissociates itself from Ku and the DNA In this manner, the helicase activity of Ku is inactivated, allowing base pairing to occur ... plasmid Visualization of in situ incorporation of DIG-dUTP in PKcs-/- cells in the absence (A) or presence (B) of transfected Tax Visualization of in situ incorporation of DIG-dUTP in PKcs-/- cells...
  • 10
  • 356
  • 0
Abstract construal of top leaders  respect as a mediator

Abstract construal of top leaders respect as a mediator

Ngày tải lên : 15/09/2015, 21:09
... construal, three items had to be dropped As indicated in Table 4, 23-item LBCS was retained as it gave an acceptable one factor model My sample is small for reliable estimates of factor loadings In ... Withholding rewards a Maintaining performance level(HLC) b Delaying raise/ recommendations/ promotions(LLC) 15 Criticizing harshly a Shouting and complaining(LLC) b Being a hard task master(HLC) ... perception of a leader is matched against an abstract prototype of a leader and this prototype is more equivalent to a high-level construal category (or abstract category) as in the case of topboss (Cantor...
  • 129
  • 149
  • 0
Reading Theory as a Microcosm of the Four Skills

Reading Theory as a Microcosm of the Four Skills

Ngày tải lên : 06/09/2013, 10:10
... difference is in their emphasis It is my belief that in giving the L2 student both as much input and practice as they can reasonably manage, and a strong metalinguistic awareness, we, as teachers give ... will most predominantly lie in the area of reading University systems in Europe, unfortunately, are dominated by the grammar-translation method of language teaching, where, as often as not, English ... Ireland and Britain One of the most important initial tasks for any teacher is the task of knowing his clients The notion of needs analysis is absolutely central Even with as few details as we...
  • 5
  • 680
  • 0
Social Phobia as a Consequence of Brain Defects

Social Phobia as a Consequence of Brain Defects

Ngày tải lên : 01/11/2013, 08:20
... typical of social phobia, are associated with rapid release of catecholamines (noradrenaline, adrenaline, and/or dopamine) and are assumed to reflect a pronounced and persistent increase in sympathetic ... unpleasant than neutral faces Arousal: Angry faces were more arousing than neutral ones: SP CTL rCBF implicit task: insula, amygdala, parahippocampal gyrus activated in SP not in CTL Dorsomedial ... during public speaking or speaking alone PET study 18 SP Results Public speaking was associated with: Increase in heart rate SP CTL Increase in perceived anxiety SP CTL Increase in CBF in the amygdala...
  • 41
  • 429
  • 0