aminotetralins as 5 ht1a serotonin receptor ligands
Báo cáo khoa học: Binding of hemolin to bacterial lipopolysaccharide and lipoteichoic acid An immunoglobulin superfamily member from insects as a pattern-recognition receptor doc
... previously [21] Binding of 1 25 I-labeled hemolin to bacteria and yeast Hemolin was labeled with 125I using Iodobead (Piece) as an iodination reagent One Iodobead was washed with 50 0 lL iodination buffer ... 25 mM Tris/ HCl, 137 mM NaCl and mM KCl, pH 7.0) and used for the agglutination assay Hemolin at 0 .5 mgÆmL)1 or BSA at 1.0 mgÆmL)1 (as a control) was used in agglutination of micro-organisms as ... buffer (50 mM Tris/HCl, 50 mM NaCl, pH 8.0, 0.1 mgÆmL)1 BSA) containing or 10 mM CaCl2, or in phosphate buffer (50 mM sodium phosphate, 50 mM NaCl, pH 8.0, 0.1 mgÆmL)1 BSA) was added at 50 lL per...
- 8
- 336
- 0
báo cáo hóa học:" Sigma-2 receptor ligands potentiate conventional chemotherapies and improve survival in models of pancreatic adenocarcinoma" ppt
... promoters [5, 7,8] The sigma-2 receptor is a unique targeting receptor that induces tumor apoptosis for pancreas cancer The sigma receptor was initially proposed as a subtype of opioid receptors ... Methods Sigma receptor ligands Sigma-2 specific ligands SV119, SV 95, and fluorescent labeled sigma-2 ligand, SW120, were synthesized and prepared as previously described [13- 15] The Sigma-1 receptor ... an additive increase in apoptosis as demonstrated by increases in TUNEL staining (Figure 2) Similar responses were noted in all cell lines when cleaved caspase was utilized as the endpoint (data...
- 8
- 726
- 0
Báo cáo hóa học: " Differential inhibition of human cytomegalovirus (HCMV) by toll-like receptor ligands mediated by interferon-beta in human foreskin fibroblasts and cervical tissue" pdf
... h at 25 C, washed three times and samples added and incubated for h at 25 C After washing, 3 .5 μg/ml polyclonal rabbit anti-human IFNβ (Chemicon) was incubated in wells for one hour at 25 C followed ... TLR2 (F 5- CTCCAATCAGGCTTCTCT-3, R 5- TCAGTATCTCGCAGTTCC-3); TLR3 (F 5- GCATTCGGAATCTGTCTCTG-3, R 5- ATTCCTGGCCTGTGAGTTCT-3); TLR4 (F 5- GATGCCAGGATGATGTCT-3, R 5- CCGCAAGTCTGTGCAATA-3); TLR9 (F 5- TACCTTGCCTGCCTTCCTAC3, ... 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 Ishii KJ, Akira S: Innate immune recognition of nucleic acids: beyond toll-like receptors Int J Cancer 20 05, 117(4) :51 7 -52 3 Ashkar AA,...
- 10
- 481
- 0
Báo cáo y học: "The utility of pathway selective estrogen receptor ligands that inhibit nuclear factor-κB transcriptional activity in models of rheumatoid arthrits" pps
... 2.13 0. 65 66.2 Mast cell protease 5. 3 11.8 5. 9 2.20 0 .50 91.4 Arachidonate 5- lipoxygenase-activating protein 18.9 46 .5 23.9 2.46 0 .51 82.0 Chemokine-like factor 10 .5 28.9 18.9 2. 75 0. 65 54.3 Phospholipase ... S-transferase 40.0 87.6 51 .2 2.19 0 .58 76.6 GTP cyclohydrolase 11.6 25. 5 23.6 2.20 0.93 13.8 Hepatic steroid hydroxylase II A2 9.0 18.7 21 .5 2.07 1. 15 -29.0 C-CAM4 protein 11 .5 24 .5 16.0 2.12 0. 65 65. 6 ... Protease Matrix metalloproteinase 2.0 8.4 3 .5 4.24 0.42 75. 8 Chymase 2.9 9.2 5. 1 3.16 0 .56 64.8 Monocarboxylate transporter 10.3 24.4 10.0 2.38 0.41 102.3 Lipocalin 16.3 55 .3 33.0 3.39 0.60 57 .1...
- 12
- 401
- 0
Báo cáo y học: "TAM receptor ligands in lupus: Protein S but not Gas6 levels reflect disease activity in systemic lupus erythematosus." ppsx
... matched (n = 45) Age (years) Normal control (n = 45) Lupus unmatched (n = 62) 40.47 ± 15. 5 41.38 ± 15. 9 37.27 ± 13.02 Sex (F:M) Ethnicity 34:11 34:11 51 :11 Caucasian 41 41 54 African 2 Asian 1 American ... 1 ACR total 5. 51 ± 1.69 5. 53 ± 1.72 Anti-dsDNA Ab (%) 33.3 22.6 Anti-Sm Ab (%) Anti-Ro (SSA) Ab (%) 28.9 42.2 12 .5 35. 5 Anti-La (SSB) Ab (%) 8.9 22.6 Anticardiolipin Ab (%) 48.8 35. 7 Lupus anticoagulant ... anticoagulant (%) 15. 6 11.7 Anti-B2 glycoprotein Ab (%) 11.1 14 .5 APS (%) 37.8 14.8 Decreased C3 (%) 8.9 4.8 Decreased C4 (%) SLEDAI 42.2 6.02 ± 4.3 30.7 4. 75 ± 4.08 BILAG 6.93 ± 5. 34 5. 59 ± 3.73 Ab,...
- 9
- 536
- 0
H RAS 12v INDUCES EXPRESSION OF RAET1 FAMILY NK RECEPTOR LIGANDS
... increased by 30% over the last two decades (Howlader et al., 2011) (Table 3) Year of Diagnosis Five-year Survival % 19 75- 1977 49.1 1978-1980 49.2 1981-1983 50 .4 1984-1986 52 .5 1987-1989 55 .5 1990-1992 ... instance, K-Ras-4B, but not KRas-4A, was essential for embryogenesis, as K-Ras-4B-deficiency was embryonically lethal (Johnson et al., 1997; Koera et al., 1997) On the other hand, H-Ras and/or N-Ras-deficient ... ……………………………………………………………………… 55 3.7 H-Ras 12V expression induces accumulation of cytoplasmic ssDNA …………………………………………………………………………………… 57 3.8 Effects of K-Ras G12D on NKG2D ligands in vivo …………………… 59 Chapter 4:...
- 86
- 77
- 0
Báo cáo khoa học: Receptor- and calcium-dependent induced inositol 1,4,5-trisphosphate increases in PC12h cells as shown by fluorescence resonance energy transfer imaging pot
... stores via the Ins(1,4 ,5) P3 receptor, a mechanism referred to as Ins(1,4 ,5) P3-induced calcium release [3] The pattern of calcium increase via Ins(1,4 ,5) P3-induced calcium release has been shown to ... Journal 274 (2007) 51 47 51 57 ª 2007 The Authors Journal compilation ª 2007 FEBS 51 55 Calcium-dependent Ins(1,4 ,5) P3 metabolism in PC12h cells M Morita et al Materials CCh was purchased from Wako ... cell-type dependence production, we assayed receptor- and 51 52 utilize it in the Ins(1,4 ,5) P3 To of Ins(1,4 ,5) P3 calcium-induced M Morita et al Ins(1,4 ,5) P3 increases in CHO cells that express m1...
- 11
- 419
- 0
Báo cáo y học: " Adding 5-hydroxytryptamine receptor type 3 antagonists may reduce drug-induced nausea in poor insight obsessive-compulsive patients taking off-label doses of selective serotonin reuptake inhibitors: a 52-week follow-up case report" potx
... are 5- HT3 antagonists with good antinausea effects Eur J Cancer Care (Engl) 2007, 16: 351 - 354 doi:10.1186/1744- 859 X-9-39 Cite this article as: Fornaro and Martino: Adding 5- hydroxytryptamine receptor ... as it was in our case While low doses (for example, 50 mg/day) of amisulpride may be suggested for dysthymia (disinhibiting presynaptic D2 receptors), higher doses (blocking postsynaptic D2 receptors) ... metoclopramide) with potential gastroprokinetics actions at high doses (possibly also from 5- HT3 receptor antagonism) Nonetheless, as apparently occurred in our case, 5- HT2A stimulation may prevail...
- 4
- 313
- 0
Báo cáo y học: "A polymorphism in the human serotonin 5-HT2A receptor gene may protect against systemic sclerosis by reducing platelet aggregation" potx
... competing interests 452 His or the 452 His/ 452 Tyr phenotype Serotonin- induced platelet aggregation 452 His/ in subjects with the or the 452 His/ 452 Tyr phenotype Fold increase of serotonin (5HT)-induced platelet ... function [5- 7] Functional study The 5- HT-to-ADP aggregation rate in 452 His/ 452 His and 452 His/ 452 Tyr healthy subjects was compared by the nonparametric Kolmogorov–Smirnov test and was then verified ... Overall, 452 His/ 452 Tyr and 452 Tyr/ 452 Tyr individuals had a threefold reduction in the risk for SSc compared with 452 His/ 452 His individuals (odds ratio = 0.39, 95% confidence interval = 0.19 to 0. 85, ...
- 7
- 411
- 0
Discovery of botanical flavonoids as dual peroxisome proliforator, activated receptor (PPAR) ligands and functional characterization of a natural PPAR polymorphism that enhances interaction with nuclear compressor
... coactivator bridge; (ii) Glu 352 , Arg4 25, and Tyr5 05, directly stabilizing the helix via salt bridges and hydrogen bonds; (iii) Lys347 and Asp503, interacting with each other as well as contacting the coactivator; ... androgen receptor base pair biochanin A calycosin centrosome-associated protein 350 coactivator-associated arginine methyltransferase CREB-binding protein complementary DNA fatty acid translocase ... 50 1.7 Flavonoids 53 1.7.1 Structure 53 1.7.2 Source 55 1.7.3 Isoflavones 56 1.7.3.1 Consumption, absorption and metabolism 56 ...
- 263
- 267
- 0
Climate change as environmental and economic hazard - phần 1.5
... B F and Landsea, C W., 2003 Assessing the skill of operational Atlantic seasonal tropical cyclone forecasts Weather and Forecasting, 18 45 – 54 Pielke, R A Jr, 20 05 Hurricanes and global warming ... J and Pasch, R., 20 05 Hurricanes and global warming Bulletin of the American Meteorological Society, 86 157 1 – 157 5 Pielke, R A Jr, Hoeppe, P and McIntyre, S., 2008 Case studies in disaster losses ... target The 2 050 reduction target was increased from 60 per cent to at least 80 per cent and the scope was extended to cover not only CO2 but the full basket of Kyoto greenhouse gases (CO2, CH4,...
- 8
- 635
- 0
Climate change as environmental and economic hazard - phần 2.5
... Journal of Sociology, 56 (4) 52 6 55 7 Berglez, P., 2008 What is global journalism? Journalism Studies, 9(6) 8 45 858 Boin, A., ’t Hart, P., Stern, E and Sundelius, B., 20 05 The Politics of Crisis ... 42(4) 50 3 50 7 Beck, U and Lau, C., 20 05 Second modernity as a research agenda: theoretical and empirical explorations in the ‘meta-change’ of modern society The British Journal of Sociology, 56 (4) ... British Journalism Review, 18(1) 50 56 Beck, U., 2002 The terrorist threat: world risk society revisited Theory, Culture and Society, 19(4) 55 Beck, U., 20 05 Freedom for technology: a call...
- 7
- 541
- 0
Sử dụng mô hình ad.as để phân tích tác động của chính sách tài khóa đến sản lượng, việc làm và giá cả. Liên hệ với việt nam trong những năm gần đây (5 năm)
... lượng hàng hóa cung ứng Tổng cung dài hạn - ASLR Tổng cung ngắn hạn - AS Tổng cung dài hạn - ASLR Đường tổng cung hàng hóa, dịch vụ dài hạn (ASLR) thẳng đứng mức sản lượng tự nhiên Cung ... Trung Quốc hay Thái Lan - 6% Mô hình kinh tế AD – AS tai Việt Nam P ASLD AS 13 P2 P1 E2 E1 AD1 AD2 y Y1 Y2 Việt Nam hiên lượng cung dài hạn ASLD thấp làm mức giá chung thấp sản lương cung thấp ... thất nghiệp giảm Khi đó: ASLD tăng từ Y2 ->Y0 Tổng cầu AD2= AD- AD2= MPC.t.Y2 MPC.t(C+I+G) Sản lượng cân tăng Y02=Y0-Y2= (1-MPC(1-t)-MPC.t).(1-MPC+MPC.t) P ASL AS AD2 P0 E0 E P2 AD AD2...
- 18
- 17,258
- 268
Tài liệu Module 5: WINS as a Solution for NetBIOS Name Resolution doc
... for LANs by using unicast protocol, which minimizes broadcast traffic h-node h-node Register, Renew, Release, Register, Renew, Release, and Query by Unicast and Query by Unicast traffic then use ... database replication As the length of time for synchronizing redundant WINS databases increases, the probability increases that a WINS server failure will result in the use of an outdated database ... answers with the class Scenario An organization has decided to restructure an existing network and include WINS as a solution for NetBIOS name resolution You are assigned the task of evaluating...
- 45
- 407
- 0
Tài liệu Báo cáo khoa học: Gas6 and protein S Vitamin K-dependent ligands for the Axl receptor tyrosine kinase subfamily pptx
... Sadick MD, Raab H & Hammonds RG (19 95) Reevaluation of the roles of protein S and Gas6 as ligands for the receptor tyrosine kinase Rse ⁄ Tyro Cell 82, 355 – 358 85 Li R, Chen J, Hammonds G, Phillips ... Cell signaling by receptor tyrosine kinases Cell 103, 211–2 25 Robinson DR, Wu YM & Lin SF (2000) The protein tyrosine kinase family of the human genome Oncogene 19, 55 48 55 57 Varnum BC, Young ... interaction was not determined Human Axl Human Gas6 Rat Gas6 Mouse Axl Rat Axl Human Sky nM [3] [23,36,82] [ 25] nM [78] 1.6 nM [79] 0.18 nM [62] 4 5 nM (Gas6 SHBG) [7 ,50 ] 0. 05 nM [49] [22, 25, 80,81]...
- 14
- 600
- 0
Tài liệu Báo cáo khoa học: Endovanilloids Putative endogenous ligands of transient receptor potential vanilloid 1 channels docx
... manner in AA released from the membrane by phospholipase A2 enzymes (Fig 3) [17] Several isoforms for both 12S- and 15S-lipoxygenases have been identified 15( S)-Lipoxygenase-1 has been found in ... amide hydrolase and the CB1 receptor in rat brain Proc R Soc Lond B Biol Sci 2 65, 2081–20 85 53 Ross, R.A (2003) Anandamide and vanilloid TRPV1 receptors Br J Pharmacol 140, 790–801 54 Ross, R.A., ... vanilloid receptor- 1 Nat Neurosci 5, 54 6 55 1 62 Chuang, H.H., Prescott, E.D., Kong, H., Shields, S., Jordt, S.E., Basbaum, A.I., Chao, M.V & Julius, D (2001) Bradykinin and nerve growth factor release...
- 8
- 370
- 0
Tài liệu Báo cáo khoa học: a-Conotoxins as tools for the elucidation of structure and function of neuronal nicotinic acetylcholine receptor subtypes doc
... ca7/5HT3 (HEK293) 103 [61] a7 61 [55 ] a3b2 1970 [55 ] a7 1710 [55 ] a3b2 241 [55 ] a7 13 [55 ] ca7 168 [59 ] ca7L247T acts as an agonist [59 ] a3b2 99 [55 ] a7 252 [55 ] ca7 349 [59 ] ca7L247T 194 [59 ] ... ha7/5HT3 Kd (B) 29 600 [58 ] ha7/5HT3 Kd (B) 148 000 [58 ] ha7/5HT3 Kd (B) 630 [58 ] ha7/5HT3 Kd (B) 61 200 [58 ] not competitive with a-BTX [ 35] rBm EC50 (B) 156 0 [ 35] ha7/5HT3 EC50(B) 407 [ 35] ha7/5HT3 ... 76 252 1710 48 4 .5 12.6 61 30 – 0.004 0.04 0.14 0.2 0.7 7.9 32 >100 [38] [83] [55 ] [55 ] [80] [80] [55 ] [55 ] [61] Consensus sequence Side chain in position 10 CAGNNQ CAANNQ –H –CH3 CAANNP CAASNP...
- 15
- 757
- 0
Báo cáo khoa học: Subcellular compartmentalization of FADD as a new level of regulation in death receptor signaling pdf
... CD 95/ FADD Y291F WT B FADD EEA-1 FADD/EEA-1 Y291F Y291F WT C WT CD 95 : 0’ 15 Y291F 30’ 60’ 0’ 15 30’ 60’ WB: Cas-8 hCD 95 D Nuclear Cytoplasmic WT Y291F CD 95: 0’ WT 0’ Y291F 0’ 15 30’ 0’ 15 ... CD 95 (CH-11) was significantly reduced as compared to wild-type CD 95 (Fig 4A) Concomitantly, the ability of CD 95( Y291F)-expressing cells to activate caspase-8 in response to CD 95 stimulation was ... z-IETD (caspase-8 selective), z-VAD (a general caspase inhibitor) or z-DEVD (caspase-3 selective) did not affect ligand-mediated CD 95 internalization at 15 and had moderate effects at 30 as compared...
- 10
- 483
- 0
Báo cáo khoa học: Functional analysis of cell-free-produced human endothelin B receptor reveals transmembrane segment 1 as an essential area for ET-1 binding and homodimer formation pptx
... [16] As observed for production of the porcine vasopressin type receptor [ 15, 22], only the steroid detergent digitonin and several long-chain polyoxyethylene derivatives such as Bri 35, Brij58 and ... b2-adrenergic receptor and vasopressin type receptor has been reported [47], and SDS-resistant dimers of CF-produced porcine vasopressin type receptor have also been detected [ 15] The ETB dimer ... expression, i.e expression as precipitate or as soluble protein, as well as the type of FEBS Journal 274 (2007) 3 257 –3269 ª 2007 The Authors Journal compilation ª 2007 FEBS 3 259 Ligand binding of cell-free...
- 13
- 433
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25