america ecosystems of pages 327 343 luis a solórzano c pdf
Tài liệu Báo cáo khoa học: "Enhanced word decomposition by calibrating the decision threshold of probabilistic models and using a model ensemble" pdf
... precision and recall not drastically change for increasing dataset sizes In Table 1b we show results for P ROMODES -H Across the datasets precision stays comparatively constant around a mean of ... direction with a net increase of 0.0819 of correct boundaries which led to the increased recall Since the deduction of precision is less than the increase of recall, a better over-all performance ... which led to a better overall performance with a calibrated threshold Conclusions We have presented a method to learn a calibrated decision threshold from a validation set and demonstrated that...
- 9
- 557
- 0
Báo cáo "Numerical study of long wave runup on a conical island " pdf
... practical problems related to long waves, such as inundation of tsunami on coastal areas. Simulated results in this study also confirm that the area behind an island can be attacked ... there was a conical island setup in a wave basin having the dimension of 30 m wide and 25 m long. The conical island has the shape of a truncated cone with diameters of 7.2 m at ... 26, 2004 Sumatra‐Andaman tsunami‐earthquake in the Indian Ocean with 9.3‐magnitude and an epicenter off the west coast of Sumatra, Indonesia had killed more than 225,000 people ...
- 9
- 556
- 0
Báo cáo sinh học: " Repressor of temperate mycobacteriophage L1 harbors a stable C-terminal domain and binds to different asymmetric operator DNAs with variable affinity" ppt
... (His-CI), a vector pSAU1180 was constructed by cloning an L1 DNA [12,17] (amplified with primers, LCP2: 5'AAGCTTCCTTTCGTTGCGCGGC and LCP3: 5'GAATTCATGAGCGGCAAAATC) to pET2 8a (Novagen, USA) This cloning ... change of each of His-CI and CTD at 42 C compared to those at 30 C Figure CD-spectra of His-CI and CTD CD-spectra of His-CI and CTD Far UV CD-spectra of His-CI and CTD (64–183 amino acid residues) ... than half of that of λ phage [1] The data also indicate that CTD is comparatively more compact than NTD at room temperature CD spectra of CI, His-CI and CTD CD spectra measurement of proteins can...
- 8
- 494
- 0
Báo cáo hóa học: " Repressor of temperate mycobacteriophage L1 harbors a stable C-terminal domain and binds to different asymmetric operator DNAs with variable affinity" ppt
... (His-CI), a vector pSAU1180 was constructed by cloning an L1 DNA [12,17] (amplified with primers, LCP2: 5'AAGCTTCCTTTCGTTGCGCGGC and LCP3: 5'GAATTCATGAGCGGCAAAATC) to pET2 8a (Novagen, USA) This cloning ... change of each of His-CI and CTD at 42 C compared to those at 30 C Figure CD-spectra of His-CI and CTD CD-spectra of His-CI and CTD Far UV CD-spectra of His-CI and CTD (64–183 amino acid residues) ... than half of that of λ phage [1] The data also indicate that CTD is comparatively more compact than NTD at room temperature CD spectra of CI, His-CI and CTD CD spectra measurement of proteins can...
- 8
- 362
- 0
The Four Pillars of Investing: Lessons for Building a Winning Portfolio_4 pdf
... “cyclical” companies with earnings that fluctuate with business cycles, such as car manufacturers, sell more cheaply than food or drug companies Put another way, since the earnings stream of an ... sociologists, economists, and psychologists—began the serious mathematical study of social phenomena In Chapter 1, we saw that a dramatic improvement in the quality of financial data occurred at ... beginning of the twentieth century This was the result of a massive collaborative effort to collect and analyze stock and bond prices As researchers began to examine the aggregate performance of stocks...
- 25
- 480
- 0
The Four Pillars of Investing: Lessons for Building a Winning Portfolio_9 pdf
... the company If analysts are too critical of the companies they are covering, that vital information—the lifeblood of their craft—could dry up in a heartbeat So the recommendations parroted back ... accounts over the course of seven years On average, that meant 76 trades per account, or about 11 per year At an average of $150 per trade, this amounts to $1,650 per year Since the median account ... pitch ideas, and close sales One journalist, after spending several days at the training facilities of Merrill Lynch and Prudential-Bache, observed that most of the trainees had no financial background...
- 25
- 476
- 0
Báo cáo hóa học: " Tuning photoluminescence of organic rubrene nanoparticles through a hydrothermal process" pdf
... Oikawa H, Matsuda H, Nakanish H: Sizedependent color and luminescences of organic microcrystals Jpn J Appl Phys 1996, 35:L221 17 Kasai H, Kamatani H, Yoshikawa Y, Okada S, Oikawa H, Watanabe A, ... the CLSM images qualitatively agreed with PL characteristics Hydrothermal processing is a promising postmanipulation technique to control PL characteristics of π-conjugated organic nanostructures ... A, Ma Y, Xiao D, Yao J: Low-Dimensional Nanomaterials Based on Small Organic Molecules: Preparation and Optoelectronic Properties Adv Mater 2008, 20:2859 16 Kasai H, Kamatani H, Okada S, Oikawa...
- 8
- 294
- 0
Báo cáo hóa học: "Research Article A Strong Convergence Theorem for a Family of Quasi-φ-Nonexpansive Mappings in a Banach Space" pdf
... spaces and consequently, it is not available in more general Banach spaces In this connection, Alber 10 recently introduced a generalized projection operator C in a Banach space X which is an ... Dekker, New York, NY, USA, 1996 11 Ya I Alber and S Reich, “An iterative method for solving a class of nonlinear operator equations in Banach spaces,” Panamerican Mathematical Journal, vol 4, no 2, ... projection operators in Banach spaces: properties and applications,” in Theory and Applications of Nonlinear Operators of Accretive and Monotone Type, A G Kartsatos, Ed., vol 178, pp 15–50, Marcel...
- 12
- 221
- 0
Báo cáo hóa học: " Research Article Quasi-Cyclic LDPC Codes of Column-Weight Two Using a Search Algorithm" pdf
... to construct a wide range of structured codes We add further constraints to search algorithms such that the obtained codes are quasicyclic This is achieved by dividing rows of a code into equal ... designed based on that configuration [10] [11] CONCLUSIONS A nonalgebraic search algorithm for constructing quasicyclic LDPC codes of column-weight two has been introduced Rows of a code are divided into ... represented by a Tanner or bipartite graph in which rows (check nodes) are one set of vertices and columns (variable nodes) are another set of vertices Check and variable nodes are connected by an edge...
- 8
- 265
- 0
The Chemistry of Food and Nutrition, by A. W. Duncan pdf
... quantity of glycogen (the animal equivalent of starch and sugar) and a variable quantity of fat Vegetable food differs much, but as a rule it contains a much smaller quantity of proteid matter, a large ... kernels C. D.—Cavendish or Figi variety of banana, analysis by D.W.M Doherty, N.S Wales P. A Petermann, U.S Cons Banana flour, musca paradisiaca variety This is widely used in Central America The ... The chief vegetable acids are: malic acid, in the apple, pear, cherry, &c. ; citric acid, in the lemon, lime, orange, gooseberry, cranberry, strawberry, raspberry, &c. ; tartaric acid, in the grape,...
- 299
- 555
- 0
Báo cáo y học: "Mannose-binding lectin deficiency is associated with early onset of polyarticular juvenile rheumatoid arthritis: a cohort study" pdf
... and had no access to earlier radiographic, clinical, or laboratory data Radiographs of other affected joints were obtained when clinically indicated The radiographic changes were classified as ... genotype groups: YA/YA, YA/XA, XA/XA, YA/O, XA/O and O/O Statistical analysis Data are presented as median and IQR because clinical and laboratory variables were not normally distributed Consequently, ... Demographic, clinical, and laboratory characteristics of JRA patients, according to disease onset subtype Characteristic All JRA patients (n = 218) JRA subgroups Polyarthritis (n = 67) P Oligoarthritis...
- 11
- 401
- 0
Báo cáo khoa học: "Delayed diagnosis of oral squamous cell carcinoma: a case series" pdf
... that patients delay seeking medical care and that access to and the quality of medical care are deficient, all of which reflect the absence of preventive public health programs and an effective ... head and neck cancer (HNC) and OSCC, delays in diagnosis of more than one month may contribute to an increased chance of the diagnosis of later-stage disease [14] Furthermore, Fortin and colleagues ... time of initial diagnosis [12] An early diagnosis is not necessarily easy, because patients and health cancers have increased in the past few decades [7,8] The major risk factors for OSCC are...
- 4
- 369
- 0
Báo cáo khoa học: "Autologous osteochondral plug transplantation for osteochondrosis of the second metatarsal head: a case report" pdf
... head was opened The articular cartilage of the second metatarsal head was found to be detached from the subchondral bone The damaged articular cartilage was removed, and a cylindrical osteochondral ... it carries the risk of necrotic changes in the metatarsal head In addition, remodeling using this technique cannot re-create an anatomically normal articular surface Recently, autologous osteochondral ... doi:10.1186/1752-1947-5-308 Cite this article as: Nagura et al.: Autologous osteochondral plug transplantation for osteochondrosis of the second metatarsal head: a case report Journal of Medical Case Reports...
- 4
- 332
- 0
Báo cáo y học: "Umbilical hernia rupture with evisceration of omentum from massive ascites: a case report" pdf
... hernia with evisceration of omentum Page of chronic elevation of intra-abdominal pressure, such as occurs with ascites, these activities and patient positions cause an additional increase in intra-abdominal ... hernia associated with hepatic cirrhosis and ascites Ann Surg 1973, 181(1):85-87 20 Granese J, Valaulikar G, Khan M, Hardy H: Ruptured umbilical hernia in a case of alcoholic cirrhosis with massive ... Ioannidis K, Cheva A, Lazou T, Michalopoulos N, Karkavelas G, Papavramidis ST: The effect of chronically increased intraabdomial pressure on rectus abdominis muscle histology an experimental...
- 3
- 365
- 0
Báo cáo y học: "Treatment of stasis dermatitis using aminaphtone: a case series" pdf
... of his leg up to the ankle region CEAP C1 telangiectasia was observed in both of his legs A clinical diagnosis of stasis purpura was made and he was medicated with 75 mg aminaphtone, twice daily ... review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar • Research which is freely available for redistribution ... Dermatologic complications of chronic venous disease: medical management and beyond Ann Vasc Surg 2007, 21(5):652-662 Kim D, Kang WH: Role of dermal melanocytes in cutaneous pigmentation of stasis...
- 3
- 298
- 0
Báo cáo y học: "Altered mental status, an unusual manifestation of early disseminated Lyme disease: A case repor" pdf
... who at baseline had dementia The authors live and practice in Connecticut which is a Lyme endemic state; as is Maine The absence of other attributable causes and the presence of an atypical rash ... normal baseline which was forgetful but coherent No icterus was noted though there was minimal conjunctival pallor Respiratory exam and cardiovascular exam was unremarkable No focal cranial nerve ... Journal of Medical Case Reports 2007, 1:62 country No changes were made recently to his medications Physical examination revealed a pleasant elderly gentleman He was hearing impaired at baseline...
- 3
- 367
- 0
Báo cáo y học: "Bleeding from ruptured hepatic metastases as a cause of syncope in an octogenarian: a case report" pdf
... http://www.jmedicalcasereports.com/content/4/1/194 complication is not uncommon in primary hepatocellular carcinoma [2] The significance of this case is that we describe acute rupture of hepatic metastases ... originating from different sources These sources include nasopharyngeal cancer [5], gastric cancer [6], lung cancer [7], renal cell carcinoma [8] and carcinoma of the liver [9] Intra-peritoneal ... care unit In view of the differential diagnosis of a possible dissection, an urgent chest and abdomen CT scan was performed which showed normal appearances of the thoracic and abdominal aorta...
- 3
- 372
- 0
báo cáo khoa học: " Upper eyelid reconstruction: a short report of an eyelid defect following a thermal burn" pdf
... lid and with absolutely sure vascularization since it contains branches of the angular artery and the infraorbital artery in its pedicle Making use of a muco-cartilaginous graft taken from the ala ... Head & Face Medicine 2009, 5:26 Figure cal incisions Drawing 1of the orbicularis oculi myocutaneous flap and surgiDrawing of the orbicularis oculi myocutaneous flap and surgical incisions ... the preparation of the orbicularis muscle as a myocutaneous temporal flap, was used to place a composite graft taken from the right auricular concha in order to lift and provide greater support...
- 3
- 209
- 0
Báo cáo y học: " Successful long-term monotherapy with rituximab in a patient with chronic lymphocytic leukemia of the B-cell-lineage: a case report" pdf
... virtual disappearance of normal leucocyte precursors and megakaryocytes on a bone marrow aspirate, as well as by a lack of efficacy Although pulmonary infections are still a dangerous consequence ... immunofixation were without pathological findings As a consequence, a watch and wait approach was chosen Upon reevaluation in December 2002, a lymphocyte doubling time of less than months was found, ... identified a CD5/CD19/CD20/CD23-positive clonal B lymphocyte population with kappa light chain expression and sIgM expression CD10/CD103/CD38/CD43/CD22 and FMC7 were all negative A chromosomal fluorescence...
- 5
- 257
- 0
project on Application of Disperse & Reactive Dyes In a P-C Blended Fabric of 65-35 In Using Two Bath System
... Company name Brand name Origin Dyes name Ciba Geigy CIBA Switzerland Cibacron Yellow FN2R Cibacron Red WB 150% Cibacron Blue FNR Cibacron Black WNN HC Cibacron Orange W 3R Cibacron Navy WRS Cibacron ... advantage of desirable performance characteristics Color: The development of decorative garments or fabric design incorporating multicolor effect Appearance: The attainment of attractive appearance ... below: Cold wash at 30 C- 50 C Hot wash at 60 C- 80 C Soap wash with anionic surfactant at 8 0C- 90 C Hot rinse at 80 C Cold rinse Technical Deficiency of Disperse & Reactive Dyes: In case of Disperse...
- 30
- 463
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu