alternative donor hematopoietic stem cell transplantation a role for umbilical cord blood transplantation for hematologic malignancies

Báo cáo y học: "Marked increase of procalcitonin after the administration of anti-thymocyte globulin in patients before hematopoietic stem cell transplantation does not indicate sepsis: a prospective study" pptx

Ngày tải lên : 13/08/2014, 16:20

... count analyzer (Advia 120; Bayer, Leverkusen, Germany) Turbidimetry (Modular SWA) was also used for analyses of alanin amino-transferase (ALT), gammaglutamyl transferase (GGT), and bilirubin to assess ... increased above 37.5°C Blood cultures were cultivated for both aerobic and anaerobic bacteria and for fungi (bacT/ ALERT; bioMérieux) Table Basic descriptive characteristics of patients Characteristic ... before hematopoietic stem cell transplantation triggered a marked increase in both procalcitonin (PCT) and C-reactive protein (CRP) with a peak at 24 hours after administration, followed by a...

7
262
0

Báo cáo y học: "Hematopoietic stem cell transplantation for systemic lupus erythematosus" ppsx

Ngày tải lên : 09/08/2014, 01:23

... feasibility and transplant-related mortality Autoimmune Disease and Lymphoma Working Parties of the European Group for Blood and Marrow Transplantation, the European League Against Rheumatism and the ... disease by hematopoietic stem cell transplantation: getting closer to a cure? Blood 2002, 99:870-887 Traynor AE, Barr WG, Rosa RM, Rodriquez J, Oyama Y, Baker S, Brush M, Burt RK: Hematopoietic stem ... None declared References 10 11 12 13 14 Marmont AM, van Lint MT, Gualandi F, Bacigalupo A: Autologous marrow stem cell transplantation for severe systemic lupus erythematosus of long duration Lupus...

3
306
0

Báo cáo y học: "Allogeneic hematopoietic stem cell transplantation for acute leukemia with Gilbert’s syndrome" pptx

Ngày tải lên : 10/08/2014, 21:23

... bioportfolio.com/news/article/23449/Karmanos-Cancer-Institute-ResearchersCollaborators-Study-Possible-Link-Between-Childhood-Leukemia-Gilbert html] Pidala J, Kim J, Anasetti C, Kharfan-Dabaja MA, Field T, ... the acquisition of data, analysis and interpretation of data, drafting of manuscript; QFL: provided the conception and design of the paper, revised it critically for important intellectual content, ... Hematology; Member of Blood Branch of the Chinese Medical Association; Member of the Chinese hematopoietic stem cell transplant group; Standing Committee member of Chinese Anti-Cancer Association...

3
366
0

Báo cáo y học: "Frequency analysis of TRBV subfamily sjTRECs to characterize T-cell reconstitution in acute leukemia patients after allogeneic hematopoietic stem cell transplantation" pot

Ngày tải lên : 10/08/2014, 21:23

... curing treatment for refractory hematopoietic malignancies and is often the only available treatment for acute leukemia The transplantation procedure/conditioning regimen generally leads to a prolonged ... served as the negative control DNA extraction Total DNA from distinct cell populations was extracted using the QIAamp DNA Blood Mini Kit (Qiagen, Germany) The quality of DNA was analyzed in 1% agarose ... leukemia patients (median age, 30.6 ± 10.2 years; range, 17-52 years; classified according to the French-American-British (FAB) criteria as 27 cases of acute lymphocytic leukemia (ALL) and 16 cases...

8
345
0

Báo cáo y học: "Acute myeloid leukemia of donor origin after allogeneic stem cell transplantation from a sibling who harbors germline XPD and XRCC3 homozygous polymorphisms" pps

Ngày tải lên : 10/08/2014, 21:23

... (AML) cells and donor s cells Polymorphism DNA repair mechanism Patient cells (pretransplantation) AML cells (posttransplantation) Donor cells XPA A2 3G NER Homozygous for optimal DRC Homozygous for ... alleles; Lane = digestion pattern from patient alleles before transplantation; Lane = digestion pattern from patient alleles from AML cell DNA after transplantation; Lane = digestion pattern from donor ... Microsatellite and PCR-RFLP analyses were performed on genomic DNA from mononuclear cells of the patient pre-transplant, of the AML blast cell sample obtained after transplantation, and of the donor...

8
306
0

Báo cáo y học: " Successful treatment of severe sinusoidal obstruction syndrome despite multiple organ failure with defibrotide after allogeneic stem cell transplantation: a case report" ppsx

Ngày tải lên : 11/08/2014, 17:21

... V, Khan SP: Use of prophylactic anticoagulation and the risk of hepatic venoocclusive disease in patients undergoing hematopoietic stem cell transplantation: a systematic review and meta-analysis ... mg four times daily was added to the antibiotic regimen Apart from voriconazole, no medication associated with microangiopathia was administered On day after transplantation, the patient developed ... times a day, escalated up to 800 mg four times a day on day 13) and 80IU unfractionated heparin/kg/day on day There was no other causal treatment Despite early treatment, multiple organ failure...

4
472
0

Báo cáo khoa học: " Challenging complications of treatment – human herpes virus 6 encephalitis and pneumonitis in a patient undergoing autologous stem cell transplantation for relapsed Hodgkin''''s disease: a case report" doc

Ngày tải lên : 12/08/2014, 04:21

... lavage Diagn Microbiol Infect Dis 2005, 52:275-280 Fujimaki K, Mori T, Kida A, Tanaka M, Kawai N, Matsushima T, Kishi K, Fujisawa S, Sakura T, Yokota A, Kanda Y, Taguchi J, Akiyama H, Kanamori ... Marty FM, Schwartz RB: MR imaging of human herpesvirus-6-associated encephalitis in patients with anterograde amnesia after allogeneic hematopoietic stem- cell transplantation AJNR Am J Neuroradiol ... Bronchoalveolar lavage was positive for HHV6b too and negative for Adenovirus, Influenza, Parainfluenza, Respiratory syncytial virus and Legionella pneumophilia Immediate treatment with foscarnet and...

3
366
0

Báo cáo khoa học: " Challenging complications of treatment – human herpes virus 6 encephalitis and pneumonitis in a patient undergoing autologous stem cell transplantation for relapsed Hodgkin''''s disease: a case report" ppsx

Ngày tải lên : 12/08/2014, 04:22

... lavage Diagn Microbiol Infect Dis 2005, 52:275-280 Fujimaki K, Mori T, Kida A, Tanaka M, Kawai N, Matsushima T, Kishi K, Fujisawa S, Sakura T, Yokota A, Kanda Y, Taguchi J, Akiyama H, Kanamori ... Marty FM, Schwartz RB: MR imaging of human herpesvirus-6-associated encephalitis in patients with anterograde amnesia after allogeneic hematopoietic stem- cell transplantation AJNR Am J Neuroradiol ... Bronchoalveolar lavage was positive for HHV6b too and negative for Adenovirus, Influenza, Parainfluenza, Respiratory syncytial virus and Legionella pneumophilia Immediate treatment with foscarnet and...

3
303
2

Tài liệu Review of Chronic Graft- Versus-Host Disease in Children After Allogeneic Stem Cell Transplantation: Nursing Perspective pptx

Ngày tải lên : 12/02/2014, 19:20

... Myelodysplastic syndrome Relapsed AML Hematological malignancy ALL Malignant and nonmalignant disease Malignant and nonmalignant disease Acute leukemia Pretransplant Disease 904 days years 1361 days ... 2.5-12 Age Range of Patients (years) Hematological malignancy Malignant and nonmalignant disease β Thalassemia major Leukemia or myelodysplastic syndrome Malignant and nonmalignant disease ALL Myelodysplastic ... GVHD Peripheral blood stem cell transplantation results in an increased risk for chronic GVHD compared with bone marrow transplantation Age at transplantation and a female donor to male recipient...

10
686
0

Tài liệu INNOVATIONS IN STEM CELL TRANSPLANTATION doc

Ngày tải lên : 18/02/2014, 04:20

... Amanda Vansan Marangon, Ana Maria Sell, Daniela Maira Cardozo and Jeane E L Visentainer Chapter The Advanced HLA Typing Strategies for Hematopoietic Stem Cell Transplantation 45 Sun Yuying and ... consequently a more accurate assessment of transplant-related complications Author details Amanda Vansan Marangon, Ana Maria Sell, Daniela Maira Cardozo and Jeane E L Visentainer Immunogenetics Laboratory, ... Hematopoietic Stem Cell Transplantation Amanda Vansan Marangon, Ana Maria Sell, Daniela Maira Cardozo and Jeane E L Visentainer Additional information is available at the end of the chapter http://dx.doi.org/10.5772/54281...

378
338
1

Tài liệu New Advances in Stem Cell Transplantation Edited by Taner Demirer ppt

Ngày tải lên : 20/02/2014, 08:20

... Hematopoietic Stem Cell Transplantation for Adult Acute Lymphoblastic Leukaemia 267 Pier Paolo Piccaluga, Stefania Paolini, Francesca Bonifazi, Giuseppe Bandini, Giuseppe Visani and Sebastian Giebel Chapter ... rabbit, cat (named Copycat) and monkey In 2006, reprogrammed murine iPSCs were reported by Takahashi and Yamanaka (Takahashi and Yamanaka, 2006) and in 2007 human iPSCs were reported (Takahashi ... Peripheral Blood Purified Stem Cells Transplantation for Treatment of Systemic Lupus Erythematosus 345 Ledong Sun and Bing Wang Chapter 17 Allogeneic Hematopoietic Cell Transplantation for Paroxysmal...

594
673
0

Báo cáo khoa học: A role for serglycin proteoglycan in granular retention and processing of mast cell secretory granule components ppt

Ngày tải lên : 07/03/2014, 11:20

... similar kinetics as for mMCP-5 In contrast, CPA protein was detected as early as after days of culture, and a maximal plateau of storage was already seen at day 12 Both proCPA and mature CPA were ... experiments As shown in Fig 3A, SG core protein mRNA was already expressed at day However, maximal MC protease accumulation was not obtained until about day 26 (Fig 3B), a ﬁnding that may appear contradictory, ... SG+ ⁄ + and SG– ⁄ – cells This was accompanied by the appearance, from about day 12, of May–Grunwald ⁄ Giemsa-positive granular ¨ structures in SG+ ⁄ + cells A gradual increase in May–Grunwald ⁄...

12
438
0

hematopoietic stem cell protocols

Ngày tải lên : 11/04/2014, 09:45

... 5’GATGAGTTTGGACAAACCAC3' YMT2 PCR primers: ymt1 5’CTGGAGCTCTACAGTGATGA3' ymt2 5’CAGTTACCAATCAACACATCAC3' Myogenin PCR primers: myo1 5’TTACGTCCATCGTGGACAGC3' myo2 5’TGGGCTGGGTGTTAGTCTTA3' 10 Deoxynucleotide ... marrow-repopulating ability Proc Natl Acad Sci USA 92, 8901–8905 Osawa, M., Hanada, K.-I., Hamada, H., and Nakauchi, H (1996) Long-term lymphohematopoietic reconstitution by a single CD34–low/negative hematopoietic ... recipients is analyzed two times for the presence of donor- derived cells: once at 1–2 mo posttransplantation as a preliminary screening for engraftment, and once at 4–6 mo posttransplantation for true...

318
390
0

báo cáo hóa học: " Function, Adjustment, Quality of Life and Symptoms (FAQS) in Allogeneic Hematopoietic Stem Cell " potx

Ngày tải lên : 20/06/2014, 15:20

... recommendations of the European Group for Blood and Marrow Transplantation, the Center for International Blood and Marrow Transplant Research, and the American Society of Blood and Marrow Transplantation ... cross-sectional and longitudinal analysis as appropriate Prior research suggests that the conditioning regimen [22], age at transplantation [27], indication for transplant (non-malignant hematological ... allogeneic hematopoietic stem- cell transplantation for acute and chronic leukemia by ethnicity in the United States and Canada J Clin Oncol 2003, 21(20):3754-3760 10 Pidala J, Anasetti C, Jim H: Quality...

9
488
0

ADVANCES IN HEMATOPOIETIC STEM CELL RESEARCH pot

Ngày tải lên : 27/06/2014, 13:20

... Carolina Garc a- de-Alba, Moisés Selman and Annie Pardo Part Hematopoietic Stem Cell Therapy 345 Chapter 16 Hematopoietic Stem Cells Therapeutic Applications 347 Carla McCrave Chapter 17 Hematopoietic ... underlying basal lamina, generating a committed suprabasal cell and a proliferative basal cell Because skin stem cells are a subpopulation of mitotically active basal epidermal cells, it is conceivable ... Multipotency and Self-Renewal Eliana Abdelhay, Luciana Pizzatti and Renata Binato Chapter Regulation of Hematopoietic Stem Cell Fate: Self-Renewal, Quiescence and Survival 39 Yasushi Kubota and Shinya Kimura...

476
340
0

Báo cáo y học: "Autoantibody profile in systemic lupus erythematosus with psychiatric manifestations: a role for anti-endothelial-cell antibodies" docx

Ngày tải lên : 09/08/2014, 01:23

... Houssiau FA, Ramirez G, Baguley E, McCutcheon J, Vianna J, Haga HJ, Swana GT, Khamashta MA, Taylor JC: Antibodies to endothelial cells in systemic lupus erythematosus: a potential marker for nephritis ... Ainiala H, Hietaharju A, Loukkola J, Peltola J, Korpela M, Metsanoja R, Auvinen A: Validity of the new American College of Rheumatology criteria for neuropsychiatric lupus syndromes: a population-based ... in accordance with the criteria of the American Rheumatism Association [25] ELISA for anti-glial fibrillar acidic protein Human glial fibrillary acidic protein (GFAP) purified from human brain...

7
431
0

Báo cáo y học: "A cell-cycle independent role for p21 in regulating synovial fibroblast migration in rheumatoid arthritis" pps

Ngày tải lên : 09/08/2014, 08:22

... the mean of quadruplicate wells ± standard error (SE) and an asterisk indicates a statistically significant difference These data are representative of three independent assays AdlacZ, adenovirus ... megapixel) camera mounted on a Nikon Eclipse TS100 inverted microscope Chemotaxis data appeared normally distributed based on examination of histogram plots, and statistical analysis was performed ... study and participated in its design and coordination All authors read and approved the final manuscript Acknowledgements The authors are supported by an Arthritis Foundation Arthritis Investigator...

8
368
0

Báo cáo y học: "Stem cell transplantation for rheumatic autoimmune diseases" potx

Ngày tải lên : 09/08/2014, 10:23

... et al.: Autologous stem cell transplantation for systemic lupus erythematosus Lupus 2004, 13:168-176 Saccardi R, Kozak T, Bocelli-Tyndall C, Fassas A, Kazis A, Havrdova E, Carreras E, Saiz A, ... Yaung K, Villa Bs M, Takahashi M, Jovanovic B, Oyama Y: Nonmyeloablative hematopoietic stem cell transplantation for systemic lupus erythematosus JAMA 2006, 295:527-535 Oyama Y, Barr WG, Statkute ... Czechowicz A, Kraft D, Weissman IL, Bhattacharya D: Efficient transplantation via antibody-based clearance of hematopoietic stem cell niches Science 2007, 318:1296-1299 Ogawa M, Matsuzaki Y, Nishikawa...

10
342
0