alsi10mg a f temper in the manufacture of hotwater heating boilers under part hc section iv
Focus - A simplicity manifesto in the Age of Distraction
... eating sweets or taking drugs, giving you a pleasure rush and making you want to the activity again, as soon as possible You get the positive reinforcement again, and again, and again, in a constant ... stream of information, we are in the crossfire of the battle for our attention, and we are engaged in a harrying blur of multitasking activity When we’re working, we have distractions coming from ... Block off a few hours a day (all at once or broken into 2-3 parts) for focus Let yourself email and other communicating during the others parts of your day »» Work in intervals Focus for 10-15 minutes,...
- 121
- 552
- 1
Báo cáo khoa học: Predicting the substrate specificity of a glycosyltransferase implicated in the production of phenolic volatiles in tomato fruit pptx
... ian hal t va A ati s 4F1 1O GT T U SG a Os an ali th A 4B T7 UG 4F2 A na ia al th a an A na a ia alia na al an th ali A th A 4C 1A 4D T7 4E T7 th na alia A th ana hali B1 ana ali A th 1A 1A ... A1 CAO69089 V vinifera ax T84 A thaliana UGT7 6F1 UG a lian tha ali ari icum th a 2F rag a 1A lian GT na copers Fa 6A tha ia an T8 H S ly S3950 A al th ali 1A 76E UGT D1 th na alia lor ico a ... of a glycosyltransferase UGT71 B1 A th aliana CaU GT1 C ro seu UG s T7 1C UG 1A T7 th UG alia 1D T8 na UG A 8A T7 th 2E ali A 2A an th a th al ia ali na an a thalia 1A th alia na na 6B1 A...
- 11
- 661
- 0
Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx
... TGCCATGAAGATCTTAGA TGAGCAGTACTACGCCATGA GTAGCCCTGCTGGTCAATGA TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CCTAATGCCCACCAATCCA (VI) TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CTAATCTATGAAATGGCAG ... parts of the brain as well as in fetal brain, PCR was carried out using the Cb common primer pair on cDNA from hippocampus, amygdala and cerebral cortex of human adult brain, and on cDNA from human ... Supplementary material The following supplementary material is available online: Fig S1 Comparison of human and Rhesus monkey PKA Cb amino acid sequence This material is available as part of the online...
- 13
- 344
- 0
Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt
... h After this period LPS was added as indicated in Fig and the cells incubated further for h after which the cell supernatant was taken for cytokine assay Incubation of the cells with IFN-c alone ... LPCAT activity may regulate the monocyte priming of and responses to LPS First, activation of plasma membrane LPCAT would likely result in elevated incorporation of polyunsaturated fatty acids into ... One for the low copy housekeeping gene U 1A and one for TNF -a The level of U 1A mRNA was similar in all samples as shown in Fig 4A This indicated equal extraction efficiency and that SK &F 98625 was...
- 7
- 322
- 0
báo cáo hóa học:" Research Article Entire Solutions for a Quasilinear Problem in the Presence of Sublinear and Super-Linear Terms" potx
... Boundary Value Problems The class of problems 1.1 appears in many nonlinear phenomena, for instance, in the theory of quasiregular and quasiconformal mappings 1–3 , in the generalized reaction-diffusion ... fluids are called pseudoplastics; if p Newtonian and if p > the fluids are called dilatants It follows by the nonnegativity of functions a, b, f, g of parameter λ and a strong maximum principle that ... which are relevant in itself and will play a key role in the proof of Theorem 1.1 We begin with the problem of finding classical solutions for the differential inequality −Δp v ≥ a x f v v > in RN...
- 16
- 438
- 0
Designation: C 465 – 99 - Processing Additions for Use in the Manufacture of Hydraulic Cements1 pdf
... processing addition in the manufacture of portland cement under this specification shall include the following information: 13.1.1 Trade name, source and character of the material, and the amount ... the addition, and the information shall form a part of the record of tests of the addition If the processing addition is a liquid, the specific gravity and percent water content shall also be part ... trade name, source, character of the material, and means for the quantitative determination of the addition in the finished cement shall be furnished by the sponsor, manufacturer, or supplier of the...
- 4
- 364
- 0
Báo cáo lâm nghiệp: "Results of a phenological study of the tree layer of a mixed stand in the region of the Drahanská vrchovina Upland" ppt
... beginning of foliage from 50%, the beginning of foliage from 100%, quite unfolded leaf area (full foliage 100%), leaf yellowing 10%, leaf yellowing 100% and leaf fall from 100% The stage of flowering ... months was sufficient in the region The sum of temperatures activating the beginning of vegetation and the onset of the particular phenological stages are decisive To evaluate the temperature demands ... budbreak 10% beginning of foliage formation 10% beginning of foliage formation 50% beginning of foliage formation 100% fully developed leaf area 100% Norway spruce 300 May 2006, the duration of the...
- 12
- 386
- 0
Báo cáo y học: " Chemokine blockade: a new era in the treatment of rheumatoid arthritis" ppsx
... inhibiting the migration of cells that are able to produce an array of proinflammatory cytokines at the site of inflammation The identification of the best targets will be the subject of future research ... during infection in light of the short half-life (the drug could be discontinued during infection, allowing inflammatory cells to migrate to the site of infection), and the potential of inhibiting ... blockade in RA Although the study was not designed to evaluate clinical efficacy, initial data were promising because one-third of the patients fulfilled the ACR20% criteria after active treatment...
- 5
- 460
- 0
Báo cáo y học: "Direct interaction of immunoglobulins with synovial fibroblasts: a missing link in the pathogenesis of rheumatoid arthritis" potx
... destruction Although a number of molecular pathways have been identified that contribute to the stable activation of RASFs, the precise cause and nature of this activation, as well as its relevance and ... consequences, are matters of debate The present data indicate very clearly that stable alterations in the fibroblasts themselves are indispensable for (auto)antibodies to exert their effects on IL-16 (and ... other data suggest that the expression of IL-16 may be regulated by different pathways in RASFs and OASFs [22] Taken together, the data alter current concepts of how the immune system interacts...
- 3
- 222
- 0
Báo cáo khoa học: "SemiPro-inflammatory cytokines play a key role in the development of radiotherapy-induced gastrointestinal mucositis" pptx
... 5’-GTGCATCATCGCTGTTCATACA TNF Forward: 5’-GTGATCGGTCCCAACAAG-3’ Results 71 X66539 Reverse: 5’-AGGGTCTGGGCCATGGAA-3’ b actin Forward: 5’-AGGCCAACCGTGAAAAGATG-3’ 101 NM_031144 Reverse: 5’-ACCAGAGGCATACAGGGACAA-3’ ... in the colon was weak-moderate over six weeks of radiotherapy Staining was variable between the basal and apical regions of the crypts and did not significantly change of the course of radiotherapy ... Gy; F = 37.5 Gy G = 45 Gy No staining was seen in the crypts of rats that had received no radiotherapy There was an increase in protein expression of TNF after radiotherapy, particularly after...
- 8
- 335
- 0
Báo cáo y học: "Accelerated cellular senescence in degenerate intervertebral discs: a possible role in the pathogenesis of intervertebral disc degeneration" ppt
... participated in the design of the study, performed the majority of the laboratory work and analysis, and drafted the manuscript AJF participated in the design of the study and interpretation of data JAH ... TAMRA 3' 5' GAC AAA TCA TCT TCA TCA CCA CCA C 3' 99.77% ADAMTS 5' GGA CCT ACC ACG AAA GCA GAT C 3' 5' FAM – CCC AGG ACA GAC CTA CGA TGC CAC C – TAMRA 3' 5' GCC GGG ACA CAC GGA GTA 3' 99.74% ADAMTS ... Richardson and Sian Parker for assistance with long-term culturing of disc cells, Sarah Heathfield for assistance with data analysis, and Basem Abdallah and Moustapha Kassem for the kind gift of the...
- 12
- 617
- 0
báo cáo khoa học: "Segregational patterns of a chromosome insertion in the progeny of twin chimeric bulls" potx
... as against cells with a normal karyotype (M et al., 1980) ORAES Because of the chimeric nature of the twins and the rarity of the insertion in the population, it was concluded that, in terms of ... of the segregational patterns of germ cells in chimeric cattle have concerned with the possibility or otherwise of the survival and function of germ cells in the gonads of bulls and freemartin ... reason In contrast to the situation in the testes of bulls born as cotwins to freemartins in which any XX cells are at a disavantage in having both the wrong X chromosome dosage and being in a...
- 5
- 319
- 0
Báo cáo y học: "Prior exposure to an attenuated Listeria vaccine does not reduce immunogenicity: pre-clinical assessment of the efficacy of a Listeria vaccine in the induction of immune responses against HIV" pps
... monkeys, indicating limited bacterial invasion into the liver, or complete clearance, by days after boost vaccination Our pilot results warrant the testing of attenuated Lm vectors as part of an orally ... by the American Foundation for AIDS Research (amfAR) Grant 02882-32-RGV, National Institutes of Health Grant AI054183 to R.M.R, National Institutes of Health Grant AI078779 to F. R .F and National ... demonstrated that oral inoculation of live attenuated Lmdd and i.v D-ala administration was safe and well tolerated in rhesus macaques Liver toxicity secondary to bacterial invasion can be a serious...
- 7
- 393
- 0
báo cáo khoa học: " The transcription factor PHR1 plays a key role in the regulation of sulfate shoot-to-root flux upon phosphate starvation in Arabidopsis" potx
... altered sulphate compartmentalization BMC Plant Biol 2010, 10:78 Tomatsu H, Takano J, Takahashi H, Watanabe-Takahashi A, Shibagaki N, Fujiwara T: An Arabidopsis thaliana high-affinity molybdate ... T, Hayashi N, Yamaya T, Takahashi H: Root-to-shoot transport of sulfate in Arabidopsis Evidence for the role of SULTR3;5 as a component of low-affinity sulfate transport system in the root vasculature ... play a role in the efflux of sulfate into the cytoplasm [16] Seeds of the sultr4;1 mutant have an enhanced sulfate content [17] The role of the two members of the SULTR5 gene family in sulfate...
- 10
- 427
- 0
Báo cáo y học: " Use of a Javid™ shunt in the management of axillary artery injury as a complication of fracture of the surgical neck of the humerus: a case report" ppsx
... a Javid™ shunt, which allowed safe internal fixation of the fracture before bypass grafting The insertion of the Javid™ shunt served to confirm the viability of the limb and adequacy of distal ... control of the subclavian artery above the clavicle (Fig 3A) Simultaneous exposure of the brachial artery in the antecubital fossa was performed and a size Fogarty embolectomy catheter passed distally ... of theof Catheter angiogram depicting pseudoaneurysm formation of third part of axillary artery with complete occlusion of the distal right brachial artery Page of (page number not for citation...
- 4
- 342
- 0
Báo cáo y học: "Soluble IL-18 receptor complex: a new star in the firmament of rheumatoid arthritis diagnosis" pptx
... the diagnosis of RA The soluble IL-18Rα complex as a biomarker may capture the complexity of the in ammatory process: the shedding of membrane IL-18Rα as a marker of enhanced proteolytic activity; ... activity; the activation and release of IL-18 by the in ammasome as a marker of innate immunity; and the alternatively spliced soluble IL-18Rβ, which is mainly expressed in the lymphoid organs and ... has no competing interests Published: 27 April 2011 References Takei S, Hoshino T, Matsunaga K, Sakazaki Y, Sawada M, Oda H, Takenaka S-I, Imaoka H, Kinoshita T, Honda S, Ida S, Fukuda T -A, Aizawa...
- 3
- 294
- 0
Báo cáo khoa học: "Pro/con clinical debate: Steroids are a key component in the treatment of SARS" pps
... regarding the use of steroids in the treatment of SARS remain unanswered, including the efficacy of this treatment, the appropriate timing of initiation of treatment, and the dose and duration of therapy ... treatment of ARDS and larger trials are in progress The appropriate timing of steroid therapy needs to be clarified Steroids have been advocated for the late immunemediated phase of the disease, although ... sepsis, and that the incidence of infectious complications is unaffected by the administration of very high doses of corticosteroid [9] Finally, in other viral pneumonias corticosteroids may be of...
- 3
- 355
- 0
a basic course in the theory of interest and derivatives markets
... of the period) Thus, the effective rate of interest in is the ratio of the amount of interest earned during the period to the amount of principal invested at the beginning of the period Note that ... where In = A( n) − A( n − 1) Note that In represents the amount of growth of the function A( t) in the nth period whereas in is the rate of growth (based on the amount in the fund at the beginning of ... The effective rate of interest for a period is the amount of interest earned in one period divided by the principal at the beginning of the period One can define the effective rate of interest for...
- 745
- 1,026
- 0
A STUDY ON GRADE 10 TH STUDENTS’ PERCEPTIONS TOWARDS LEARNING TO READ ENGLISH AT A HIGH SCHOOL IN THE NORTH OF VIETNAM
... an approach to teaching and learning reading that uses reading materials that are understandable and meaningful to the learner in order for learners to be able to read large amounts The aim of ... understanding of the material The second is readers often use this kind of reading to find out the meaning of the whole text rather the meaning of individual words or sentences The last one is extensive ... indicate that, generally, multiple factors may play a crucial role in the creation of reading habits Research has also found that an important factor in the development of a reading habit is a positive...
- 63
- 587
- 1
A new direction in the study of the orientation number of a graph
... h a p t e r b y e xa m in in g t h e family o f g r a p h s ( r a t h e r t h a n ju s t a particular g r a p h ) o b t a in e d b y a d d in g p e d g e s b e t we e n Kp a n d Cp in a n a ... h t h a t an → bk in F fo r s o m e an ∈ A W e c a n a lwa ys fi n d s u c h an s in c e Sk = A B u t n o w d( bk , an ) > , a g a in a c o n t r a d ic t io n ( S e e Fig u r e 2 ) If A ∗ is ... c a s e , ie aj → B ∗ Th e n d( b∗ , aj ) ≤ fo r a ll b∗ ∈ B ∗ im p lie s B ∗ → a; a n d fo r a ll al ∈ A \ {aj }, d( al , aj ) ≤ im p lie s al → a Th is m e a n s t h a t A = {aj } a n d A...
- 226
- 350
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose