alike a dental nonmetric analysis of population diversity at the dawn of the chinese empire 770 bc ad 420
Báo cáo y học: " Laugh Yourself into a Healthier Person: A Cross Cultural Analysis of the Effects of Varying Levels of Laughter on Health"
Ngày tải lên :
26/10/2012, 09:57
... pathways, the “voluntary path” and the “involuntary path” otherwise known as the “emotionally-driven path” (5) The voluntary pathway begins from the premotor opercular areas and travels via the ... cortex and pyramidal tract to the ventral brain stem The involuntary path is comprised of amygdala, thalamic, hypothalamic, and subthalamic areas, in addition to the dorsal brain stem Moreover, the ... Statistical analysis The data was analyzed using both parametric and non parametric statistics and the specific test used was indicated with the respective results If assumptions of normality and...
- 12
- 757
- 0
Báo cáo y học: "Discriminating between elderly and young using a fractal dimension analysis of centre of pressure"
Ngày tải lên :
03/11/2012, 10:09
... non-linear analysis technique applied to quiet stance COP data Results from the surrogate data analysis indicated that variation inherent in the COP data was not due to random fluctuations but rather, ... recognising the chaotic properties of natural phenomena and the use of appropriate non-linear analysis, such as fractal analysis, in place of traditional analyses [1] A strong reason behind this paradigm ... is also not an appropriate variable that is informative about COP control This research demonstrates that a fractal dimension analysis can inform about COP data equally as well as a traditional...
- 10
- 457
- 0
A critical discourse analysis of the news on north korean missile launches part 3
Ngày tải lên :
07/11/2012, 14:39
... Positivization of the US- Japan coalition’s activities in VOA Table Lexicalization of North Korea’s activities in Nhan Dan Table Lexicalization of the US-Japan coalition’s activities in Nhan Dan Table ... LIST OF TABLES Table Names for US-Japan coalition and North Korea in VOA Table Names for US-Japan coalition and North Korea in Nhan Dan Table Negativization of North Korea’s activities in VOA Table ... Over-lexicalization of the North Korea’s missile launches in VOA Table Over-lexicalization of the North Korea’s missile launches in Nhan Dan Table Quotation patterns of news reports in VOA Table 10...
- 4
- 828
- 6
A critical discourse analysis of the news on north korean missile launches part 4
Ngày tải lên :
07/11/2012, 14:39
... Headline plays a crucial role in a news report; it is the headline that first catches the readers’ eyes Just by glancing at the headline, readers can get the general idea of what the news is about ... from the Voice of America and Nhan Dan These two sources are chosen as the database for the analysis as they are both popular and reliable sources of information 2.1.1.1 Voice Of America The Voice ... describes the sources of data as well as the research procedures that have been utilized in the study Chapter 3- Data Analysis and Discussion: This chapter analyzes the data and discusses the findings...
- 20
- 811
- 0
A critical discourse analysis of the news on north korean missile launches part 5
Ngày tải lên :
07/11/2012, 14:39
... generated a negative image of North Korea on the readers’ mind Like the US and Japan, North Korea is also engaged mainly in material and verbal processes: material 40%, verbal 46.7% and relational ... processes are attributed to the US and Japan (76.9%) and all these processes are either verbal (60%) or material (40%) The US and Japan play the role of actor and sayer in all the processes In material ... explicitly associates the US and Japan with positive values and goals 3.2.2.2 Nhan Dan The analysis of lexicalization shows that in Nhan Dan the wordings for North Korea’s and the US- Japan coalition’s...
- 28
- 603
- 1
A critical discourse analysis of the news on north korean missile launches part 6
Ngày tải lên :
07/11/2012, 14:39
... II APPENDIX Headlines from Nhan Dan ND1* Triều Tiên thử tên l a, Mỹ Nhật Bản đe d a trừng phạt 05/07/2006 ND2* Trung Quốc quan tâm, Nhật Bản tiếp tục đàm phán vấn đề tên l a Triều Tiên ... Trung Quốc Nga đ a dự thảo nghị vấn đề tên l a Triều Tiên 13/07/2006 ND10 Các nước thường trực HĐBA LHQ họp vấn đề tên l a Bình Nhưỡng 14/07/2006 ND11* LHQ thông qua nghị vấn đề tên l a Triều Tiên ... trừng phạt thêm Mỹ Triều Tiên 21/07/2006 Note : The news reports marked with (*) are sampled for full-text analysis III ...
- 3
- 761
- 3
A critical discourse analysis of the news on north korean missile launches part 8
Ngày tải lên :
07/11/2012, 14:39
... VOA Formal and neutral names for the US and Japan Negative names for NK Nhan Dan formal and neutral names for both groups of participants lexicalization VOA Negativization of NK’s activities ... of America and Nhan Dan Aims of the research To provide a textual analysis To give an illustration of CDA concepts and analysis procedures To convey a message Research questions What are the ... the roles ? Analyzing full-text news reports Naming referents Lexicalization Over-lexicalization Quotation patterns Data analysis and discussion Analysis of headlines Analysis of full-text...
- 23
- 712
- 0
A critical discourse analysis of globalization discourse
Ngày tải lên :
07/09/2013, 12:58
... basis for the analysis of the speech The Backlash against Globalization’ in chapter Chapter 3: A Critical Discourse Analysis of the speech The Backlash against Globalization’ This chapter applies ... negative? What relational values grammatical features have? What modes are used? Are there important features of relational modality? Are the pronouns we and you used? And if so, how? 20 What ... Director-General Mike Moore is fully aware of the fact that people are against globalization ‘But there has been a backlash against liberalism For a start, statist urges are alive and well The traditional...
- 45
- 754
- 6
A CRITICAL DISCOURSE ANALYSIS OF MARTIN LUTHER KING’S SPEECH ‘BEYOND VIETNAM – a TIME TO BREAK SILENCE’
Ngày tải lên :
07/09/2013, 12:58
... Material Material Behavioral Relational Material Material Material Verbal Material Material Material Verbal Verbal Material Material Mental Material Relational Relational Material Material Material ... Behavioral Material Material Material Material Behavioral Material Material Relational Relational Existential Material Material Material Material Material Mental Material Material Material Behavioral ... Mental Material Mental Material Material Verbal Mental Relational Mental Verbal Material Material Material Material Mental Relational Relational Material Relational Material Material Material Material...
- 38
- 1K
- 7
A cross cultural analysis of english textbook for grade 10 and suggestion of supplementary activities for students’ cross cultural awareness
Ngày tải lên :
07/09/2013, 12:58
... States of America, Australia, Canada, New Zealand and Ireland In fact, as the statistics show, information about the United Kingdom and the United States of America has the most coverage in the whole ... are these appropriate to the learners' native culture? Would additional information be necessary to explain them or are they selfexplanatory? 12 What are the activities asked of the learners? Are ... illustrations) are also employed for analysis when and if appropriate The study just makes an initial attempt to conduct a small-scale cross-cultural analysis of the textbook and is not aimed at evaluating...
- 51
- 1.4K
- 16
A critical discourse analysis of president bush’s speech outlining strategy for victory in iraq
Ngày tải lên :
29/01/2014, 00:23
... B - - : 78 A # M * # ! B - A * * % 73 , ) $ %6 &&4 ) A # A # # B - A A B , -% 73 $ @ ) # A % &'') ! # ? # / ; 5 * * / * * + , - A / A A / / ( % ) , - # - / < # * # % ) # # # # $ A 26 * I+ ... * ) +D % # - ' A +D # # # # * # # * # ; # A 7< # %A # 4FF ) ;< ;< ;< * ;< < # J J ! H ;< # # # M M "* / , ;< * ! ;< A ; A : ) /< % # A # 5 "*" # * % # ) # - # /B - ! - & - A ! N # 7 # ? ... # * # A % ) % #) +D % - ) # A # B - B - 4F +D % - ) +D A +D D %+D) 6 # # # 6 + ; * # ' B %8 A 4FF &) **+ +D #0 D # - +D +D % ) * * B - +D A +D +D * # # 7 6 < +D +D 6 I < ' %8 A ! 60 A 4FF :C)...
- 85
- 645
- 5
A Cost-Benefit Analysis of the National Guard Youth ChalleNGe Program pot
Ngày tải lên :
30/03/2014, 05:20
... Table 4.4 Estimated Effect of Educational Attainment at Age 20 on the PDV of Cash Transfers Educational Attainment at Age 20 GED Estimated Effect of Educational Attainment on PDV of Cash Transfers ... program evaluation (i.e., the educational categories as defined are not mutually exclusive) Table 4.1 Estimated Effect of Educational Attainment at Age 20 on PDVE Educational Attainment at Age ... higher educational attainment induced by the ChalleNGe program We also value the effect of educational attainment on social welfare dependency and generate separate estimates of the value of the effect...
- 69
- 342
- 0
báo cáo sinh học:" What impact do Global Health Initiatives have on human resources for antiretroviral treatment roll-out? A qualitative policy analysis of implementation processes in Zambia" pptx
Ngày tải lên :
18/06/2014, 17:20
... validation of data collected Given the recent, unfolding nature of the ART roll-out, and the limited secondary data available, this paper provides an empirical, contemporary spotlight Page of ... targeted at alleviating staff shortages to avoid creating an ever-growing dependency of the Zambian treatment programme on external actors Competing interests The authors declare that they have ... remained problematic A senior official at the Ministry of Health said: "In Lusaka alone there are close to 236 partners working on HIV to track what they are doing is a challenge" [interview, national...
- 9
- 594
- 0
báo cáo sinh học:" Community characteristics that attract physicians in Japan: a cross-sectional analysis of community demographic and economic factors" potx
Ngày tải lên :
18/06/2014, 17:20
... variable-to -population ratios For population and daytime population, variable-to-area ratios were used instead of variable-to -population ratios because these variables directly represent population If the ... unknown whether the population alone is the best parameter of the community attractiveness among many available variables There are no studies that have evaluated the many potential associations ... municipality-based data because of the high availability and accuracy of the data, particularly in terms of demographics and health care variables Moreover, municipality-based analysis of physician...
- 10
- 477
- 0
Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot
Ngày tải lên :
18/06/2014, 22:20
... hantavirus recombination awaits further investigation Conclusion The data presented in this paper show that the recTULV presents no real match to the original cell adapted variant and that the ... stage of nested PCR gave exactly the same result The V-type S RNA was detected during all ten passages while the REC-type totally disappeared after the 5th passage (data not shown) These data confirmed ... presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To monitor the presence of...
- 5
- 483
- 0
báo cáo hóa học:" Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" ppt
Ngày tải lên :
20/06/2014, 04:20
... hantavirus recombination awaits further investigation Conclusion The data presented in this paper show that the recTULV presents no real match to the original cell adapted variant and that the ... stage of nested PCR gave exactly the same result The V-type S RNA was detected during all ten passages while the REC-type totally disappeared after the 5th passage (data not shown) These data confirmed ... presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To monitor the presence of...
- 5
- 430
- 0