albumin mip 2 kc tnf a and il 1b in bal fluid
Báo cáo y học: " Endothelial cell apoptosis in chronically obstructed and reperfused pulmonary artery" pps
Ngày tải lên :
12/08/2014, 15:21
... other organs, such as the heart and kidney [20 ,21 ] Caspase inhibitors are now available commercially and their potential benefits in transplant patients are being evaluated in clinical trials In conclusion, ... Keshavjee S: Caspase inhibition improves ischemia-reperfusion injury after lung transplantation Am J transplant 20 05, 5 :29 2-9 Yaoita H, Ogawa K, Maehara K, Maruyama Y: Attenuation of ischemia/reperfusion ... group and sham group Statistical analysis Data are expressed as mean ± SD One-way analysis of variance and simple linear regression studies were done using the Statview software package version (Abacus...
- 10
- 264
- 0
Báo cáo y học: " Effects of cigarette smoke on endothelial function of pulmonary arteries in the guinea pig" ppsx
Ngày tải lên :
12/08/2014, 14:20
... aorta and main pulmonary artery sections stained with elastin-Van Gienson The external and internal elastic laminas were outlined and both total and lumen areas were computed using an image analysis ... following institutional guidelines that comply with national (Generalitat de Catalunya decree 21 4/1997, DOGC 24 50) and international (Guide for the Care and Use of Laboratory Animals, National Institutes ... 2. 22 (2. 07 2. 32) 0.50 (0.46–0.65) 77 (70–87) 2. 28 (2. 24 2. 36) 0.63 (0.57–0.74) 88 (80–97) Wall thickness was calculated as total area/external perimeter Values are median and interquartile range...
- 11
- 349
- 0
Báo cáo khoa học: " Influence of ascorbic acid on BUN, creatinine, resistive index in canine renal ischemia-reperfusion injury" pps
Ngày tải lên :
07/08/2014, 18:21
... gnirud aimeru fo sngis lacinilc on dah spuorg htob fo sgod llA stluseR tnacifingis yllacitsitats sa nekat erew 50.0 < p ta secnereffiD tset-t tnedutS dna AVONA yb detaulave saw sisylana lacitsitatS ... dna ylralullecartni seiceps tnadixo evitcaer secuder hcihw tnadixoitna sihT amsalp ni tnadixoitna elbulos-retaw niam a si dica cibrocsA yrujni R/I retfa detaulave erew ledom god eht ni IR dna ... stnemirepxe fo hcae rof )DS( noitaived dradnats dna naem sa desserpxe saw ataD gnilpmas doolb fo emit eht ta detcudnoc osla erew seiretra lanerartni fo )IR( xedni evitsiser fo tnemerusaem htiw )aeroK ,nosideM(...
- 3
- 273
- 0
Báo cáo y học: " Effects of ischemic preconditioning on ischemia/ reperfusion-induced arrhythmias by upregulatation of connexin 43 expression" ppt
Ngày tải lên :
10/08/2014, 09:21
... Under sterile conditions, a median abdominal incision was made and the peritoneum was slit to expose the abdominal aorta Finally the abdominal aorta was banded with the support of a hard catheter ... 11:158-165 20 Schulz R, Heusch G: Connexin43 and ischemic preconditioning Cardiovascular gap junctions Adv Card 20 06, 42: 213 -22 7 21 Garcia-Dorado D, Ruiz-Meana M, Padilla F, Rodriguez-Sinovas A, Mirabet ... left anterior descending coronary artery (LAD), and after the attainment of steady state heartbeat for 15 min, a 400 U/kg IV dose of heparin was administered and the LAD was ligated for 15 to induce...
- 6
- 351
- 0
Báo cáo y học: "Pharmacological evaluation of tacrolimus (FK-506) on ischemia reperfusion induced vasculatic neuropathic pain in rats" ppt
Ngày tải lên :
10/08/2014, 10:20
... paw withdrawal threshold and paw lifting duration, as an index of heat hyperalgesia and chemical allodynia by using hot plate, radiant heat lamp and acetone applicator respectively as shown in ... maintained at 52. 5 ± 0.5°C Duration of the tail withdrawal reflex was recorded, as a response of spinal heat sensation and a cut-off time of 15 s was maintained Tail flick test Spinal thermal ... decrease in free radical accumulation and inflammatory markers as well as its calcium modulatory actions [18,44] Histopathological evaluation had also revealed I/R induced axonal degeneration In fact...
- 11
- 386
- 0
Báo cáo y học: "Beneficial effect of the oxygen free radical scavenger amifostine (WR-2721) on spinal cord ischemia/reperfusion injury in rabbits" docx
Ngày tải lên :
10/08/2014, 10:20
... placed in supine position and allowed to breathe spontaneously with O2 via face mask (FiO2 35%) A 22 -gauge venous catheter was placed in the marginal ear vein and CEFAZOLINE SODIUM (VIFAZOLINEđ, ... Company) was infused at a rate of 4-10 ml/kg/h, maintaining mean blood pressure between 85 to 100 mmHg [16] Placing a heating pad under the animal and exposing it to a heat lamp maintained animal body ... protein mg from a 00.05 mg BSA standard curve (against appropriate sample and reagent blanks) A Shimadzu UV-VIS 120 1 spectrophotometer was used Statistical Analysis Data represent mean one standard...
- 12
- 349
- 0
Báo cáo y học: "Antioxidant effects of ethyl acetate extract of Desmodium gangeticum root on myocardial ischemia reperfusion injury in rat hearts" pps
Ngày tải lên :
13/08/2014, 15:21
... SASTRA University, Thirumalaisamudram, Thanjavur, Tamil Nadu, India 2SASTRA University, Thirumalaisamudram, Thanjavur, Tamil Nadu, India 3Department of Plant Biotechnology, Amala Cancer Research ... of lactate dehydrogenase and creatine kinase in coronary perfusate of isolated rat Table Activities of creatine kinase, lactate dehydrogenase, SGOT, and SGPT in the tissue homogenate of isolated ... authors declare that they have no competing interests Received: August 20 09 Accepted: 22 January 20 10 Published: 22 January 20 10 References Hasani-Ranjbar S, Larijani B, Abdollahi M: A systematic review...
- 7
- 346
- 0
Báo cáo y học: "Emulsified Isoflurane Preconditioning Reduces Lung Injury Induced By Hepatic Ischemia/Reperfusion in Rats"
Ngày tải lên :
25/10/2012, 11:00
... Military Medical University, Shanghai, China) were maintained in laminar flow cages in a specific pathogen free animal facility, and allowed free access to standard laboratory chow and water ... temperature was monitored by a rectal probe and maintained at around 37℃ by a heating lamp The right carotid artery was cannulated for arterial blood monitoring and blood-gas analysis, and the ... gut and liver I/R injury 22 This process is associated with activation of inflammatory reaction, including the increased activity of NF-κB and the increased inflammatory mediators such as TNF- α and...
- 9
- 389
- 0
Báo cáo y học: "Primary lower limb lymphedema: a focus on its functional, social and emotional impac"
Ngày tải lên :
25/10/2012, 11:40
... of gestation (2 years ago) described a progressive painless enlargement on the left ankle, proximally extended, leading to impaired daily activity and creating a sensation of heaviness and discomfort ... limb edema The swelling was initially presented at the age of years from the left ankle progressing slowly up to the calf, thigh and inguinal area leading to disfigurement and functional impairment ... elastic stockings, physical activity and avoidance of trauma Currently, he reports at least two episodes of cellulitis annually Physical examination revealed an erythematous non-pitting edema...
- 5
- 443
- 0
The impact of technology on team functioning within a given organization
Ngày tải lên :
21/12/2013, 00:26
... Contrast with formal group, with individual needs and demand, people gather creating informal group Within formal organization, it can appear a lot of informal groups Informal group relates more ... Professional Education, Aldine House, Aldine Place Phillips J (20 05) The Smaller the Better, Thinking Faster, Available from: http://www.lifehack.org/articles/lifehack/advantages-of -a- smaller-team.html ... reluctant to Phillips J (20 05) The Smaller the Better, Thinking Faster, Available from: http://www.lifehack.org/articles/lifehack/advantages-of -a- smaller-team.html [ accessed 22 May 20 08 ] A Overholt...
- 9
- 3.2K
- 2
Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf
Ngày tải lên :
20/02/2014, 01:20
... equimolar amounts of Akazara scallop TnC Lanes h and m, ATnI-52K; lanes i and n, ATnI-19K; lanes j and o, ATnI1) 128 ; lanes k and p, ATnI130 )25 2; lanes l and q, ATnI2 32) 2 92; lane r, Akazara scallop ... (5¢-CTTGATTTGGATCCTTTAAGGTA TAGC-3¢), ATnI1F and ATnI 128 R (5¢-GTTCCGGATC CTATCTTCTGGCTTCC-3¢), ATnI130F (5¢-GCCAGAA CCATGGCGGAGGAAC-3¢) and ATnI292R, ATnI130F and ATnI252R (5¢-CAAGTTTGGGATCCTATTTGTTAA CTTTTC-3¢), ... ATnI130 )25 2 (fragment; residues 130 25 2), and ATnI2 32) 2 92 (fragment; residues 23 2 29 2), combinations of the forward and reverse primers, ATnI1F (5¢-CATATCACCATGGGTTCCCTTG-3¢) and ATnI292R (5¢-CTTGATTTGGATCCTTTAAGGTA...
- 12
- 514
- 0
Aging of the Respiratory System: Impact on Pulmonary Function Tests and Adaptation to Exertion pdf
Ngày tải lên :
05/03/2014, 21:20
... 474 janssens gested as an important mechanism for the age-related decrease in Pao2, increase in alveolar-arterial difference in partial pressure of oxygen (Pao2 À Pao2), and decrease in carbon ... physical tasks declines with advancing age Vo2max, expressed in L Á minÀ1, reaches a peak between 20 and 30 years of age Longitudinal and cross-sectional studies thereafter show a decrease in Vo2max ... healthy adults decreases with age: Tanaka and colleagues, in a recent a meta-analysis compiling data from 18,7 12 subjects, show that maximal HR is independent of sex and level of physical activity and...
- 16
- 873
- 0
Báo cáo khoa học: The influence of heterodimer partner ultraspiracle/retinoid X receptor on the function of ecdysone receptor pot
Ngày tải lên :
07/03/2014, 12:20
... collected at 0, 1, 3, 6, 12, 24 , 48 and 72 h after adding ligand and reporter activity was quantified The fly luciferase activity was normalized using Renilla luciferase activity The values presented are ... applications in agriculture and medicine Vitamins Hormones in press 25 Billas IM, Iwema T, Garnier JM, Mitschler A, Rochel N & Moras D (20 03) Structural adaptability in the ligand-binding pocket ... electroporation of plasmid SEAP in mouse sera was evaluated for up to 17 days after ligand administration Values are the average from seven animals ± SD ches peak levels in the presence of 25 lm RG-1 022 40...
- 12
- 398
- 0
Báo cáo khoa học: Adhesion properties of adhesion-regulating molecule 1 protein on endothelial cells pptx
Ngày tải lên :
07/03/2014, 17:20
... present in species as different as human (110-kDa antigen, isolated from gastric carcinoma cells) [18,19], rat [20 ], chicken, Xenopus laevis [21 ,22 ], Drosophilia melanogaster, Arabidopsis thaliana and ... densitometric analysis after normalization against actin (B) RT-PCR was used The cDNA of interest was coamplified with an actin cDNA fragment as an internal control ARM-1 is differentially expressed in endothelial ... Paris, France EL4 and FEBS Journal 27 2 (20 05) 1833–1844 ª 20 05 FEBS N Lamerant and C Kieda EL4 -IL2 are mouse activated T lymphocytes, NKL1 and NKL2 are human natural killer cells, kindly provided...
- 12
- 368
- 0
Báo cáo khoa học: Studies on structure–function relationships of indolepyruvate decarboxylase from Enterobacter cloacae, a key enzyme of the indole acetic acid pathway ppt
Ngày tải lên :
08/03/2014, 02:20
... mLÆmin)1 at °C and detected by the protein absorbance at 28 0 nm Ferritin (450 kDa), catalase (24 0 kDa), BSA (68 kDa), and ovalbumin (45 kDa) (Combithek, calibration proteins for chromatography, ... protein utilizing the principle of protein-dye binding Anal Biochem 72, 24 8 25 4 14 Hallmann, G & Hagle, H (1963) Benzofuranderivate: Trypta¨ min-, Serotonin- und Melatonin-Analoga Liebigs Ann ... (1988) Data acquisition systems for linear and area X-ray detectors using delay line readout Nucl Instrum Methods A2 69, 3 12 320 23 Gabriel, A & Dauvergne, F (19 82) The localisation method used at...
- 10
- 430
- 0
Báo cáo khoa học: Protein engineering of pyruvate carboxylase Investigation on the function of acetyl-CoA and the quaternary structure doc
Ngày tải lên :
16/03/2014, 16:20
... as follows: an % 400 bp fragment was amplied with pPC as template using the following primers: CT1, 5Â-ATATCCATGGCACGCCGGAAAGACGGAACGA AAATG-3Â and CT2, 5Â-CCGATCCCACGGATCCTCT TTTAAAAAGCG-3Â (restriction ... dehydrogenase and variable concentrations of oxalacetate and oxamate at 30 C (A) Oxamate was the varied substrate with 0.1 mM oxalacetate (B) Oxalacetate was the varied substrate with 1.0 mM oxamate ... ribonuclease A (13.7 kDa), chymotrypsinogen A (23 kDa), ovalbumin (43 kDa), albumin (67 kDa), aldolase (158 kDa) and thyroglobulin (669 kDa) Elution times of intact PC and engineered proteins are...
- 10
- 397
- 0
Báo cáo khoa học: Effect of valine 106 on structure–function relation of cytosolic human thymidine kinase Kinetic properties and oligomerization pattern of nine substitution mutants of V106 ppt
Ngày tải lên :
16/03/2014, 16:20
... GGGGGATCCTGCA CACATGACCGGAACACC (24 7 27 3)-3¢ designed to contain a GGG overhang and an antisense primer: 5¢-CGGCACCGAATTCTAGATGGCCCCAAATGGC TTCCT(480–445)-3¢ The numbering is as described in [16] ... 5¢-CAGTTTT TCCCTGACATCATGGAGTTCTGCGAGGCCATG (355–393)-3¢; antisense primer, 5¢-CATGGCCTCGCAGA ACTCCATGATGTCAGGGAAAAACTG(393–355)-3¢ The changed bases are underlined DNA sequencing pGEX-2T-LyTK1Val106, ... determinations buffer B containing 30% glycerol and mM ATP for enzyme stabilization, and assayed for thymidine kinase activity at standard assay conditions with 100 lM thymidine The native molecular...
- 9
- 447
- 0
Consumer market study on the functioning of e-commerce and Internet marketing and selling techniques in the retail of goods potx
Ngày tải lên :
23/03/2014, 08:21
... time, taxes, and availability of products There is a lack of clarity and choice about default rankings; and importantly a lack of information about payments from traders for ranking placements and ... time, taxes, and availability of products There is a lack of clarity and choice about default rankings; and importantly a lack of information about payments for ranking placements and listings Other ... share of Internet retailing in the EU are 9 .2 billion Euro, and total welfare gains resulting from larger online choices under a hypothetical situation of a 15% share of Internet retailing and...
- 223
- 1.7K
- 0
Charity Law & Social Policy National and International Perspectives on the Functions of the Law Relating to Charities pptx
Ngày tải lên :
29/03/2014, 05:20
... 23 4 23 4 23 5 23 5 23 6 23 7 23 8 23 9 24 1 24 2 24 2 24 3 24 3 24 4 24 4 24 7 24 9 25 0 25 1 25 1 25 2 25 2 25 3 25 4 25 7 25 7 25 8 25 8 26 1 26 2 26 3 26 3 26 4 26 4 26 5 26 5 26 5 26 6 26 7 26 8 xviii Contents The United States ... Business Activities 27 1 27 2 27 2 27 3 27 3 27 4 27 5 27 5 27 5 27 6 27 6 27 7 27 7 27 7 27 8 27 8 27 9 28 0 28 2 28 4 28 6 28 6 28 6 28 7 28 9 28 9 29 0 29 0 29 0 29 1 29 2 29 2 29 3 29 4 ... 22 0 22 0 22 1 22 1 22 1 22 2 22 2 22 2 22 3 22 4 International Perspectives Australia 22 7 Introduction A...
- 623
- 524
- 0
Báo cáo sinh học: "Adipose-Derived Mesenchymal Stem Cell Protects Kidneys against Ischemia-Reperfusion Injury through Suppressing Oxidative Stress and Inflammatory Reaction" ppt
Ngày tải lên :
18/06/2014, 19:20
... plus inhalational isoflurane and placed in a supine position on a warming pad at 37°C Renal IR was then conducted in group and group animals on which a midline laparotomy was performed Bilateral ... nitrogen (BUN) and creatinine, urine amount, and the ratio of urine protein to creatinine Serum levels of blood urea nitrogen (BUN) and creatinine and the ratio of urine protein to creatinine in three ... study animals for estimating daily urine volume and measuring the ratio of urine protein to urine creatinine excretion Quantification of urine protein, BUN, and creatinine level was performed using...
- 17
- 327
- 0