... CGGGCCCGGGATCCATC gccacc ATGG TGA; the 3¢ interface is CAAGTAAA GCGGCCGC For pEBTetD ⁄ eGFP, the 5¢ interface is identical; the 3¢ interface is CAAGTAAA GCGGCCGCGG Cell culture, transfection, and flow ... graded transactivation potential Nucleic Acids Res 25, 2723–2729 13 Akagi K, Kanai M, Saya H, Kozu T & Berns A (2001) A novel tetracycline-dependent transactivator with E2F4 transcriptional activation ... for transporter mRNA and GAPDH mRNA With OCT1, OCT2, and CAT4 both vectors were analyzed alongside on asingle blot OCT, organic cation transporter; CAT, cationic amino acid transporter Transporter...
... each treatment on each genotype at each temperature was tested separately by using a one way analysis of variance (ANOVA) Mean separation was done by student’s t-test Data processing and statistical ... tomato, citrus and Arabidopsis [2,5,27] Mutations in Arabidopsis ARF8 can provide parthenocarpy, but it can also be obtained when defective forms of ARF8 are expressed in Arabidopsis and tomato ... size C annuum has an axillar placenta where ovules develop in a gradient from top to bottom The majority of the ovules are anatropous and unitegmic, as is characteristic for the Solanaceae family...
... purposes) Acta Veterinaria Scandinavica 2009, 51:4 lactation and in lactation number or The herd is comparable to an average Swedish dairy herd regarding lactation stage and age distribution among ... for analysis of casein and FFA were collected in the afternoon milkings, at days -1 and from all cows At days and casein and FFA was analysed in milk only from cows which during day had a pronounced ... repeated measure ANOVA (Analysis of Variance) in SAS 9.1 (SAS Institute, Cary, NC, USA, 2002) To obtain normal distribution, the data on SCC were transformed to 10 logarithmic values before the analysis...
... observational measurement methods mentioned earlier To display progress and organize tasks, graphical aids and sequential graphic agendas of work are used Data are graphed to provide visual pictures ... an analogue scale The questionnaire was administered after and years from entry into the service Statistical analysis The intraclass correlation coefficient [32] was calculated as the reliability ... intervention: as a matter of fact, early intervention is not always the rule, and those affected are often taken in for treatment in late infancy or adolescence or not treated at all Facing this scenario,...
... and when a user selects a new item in the list, a Select statement is generated and loaded into a data adapter, which fills a data table This, in turn, is used for the data source of the data ... data, but also resets what columns are being used in the data table object You can see that mdtLookupData is being stored to a Session object entry called MyDataTable, and a Boolean variable called ... create a data table Then set the ' data source of the data grid odaTableData = New OleDb.OleDbDataAdapter("Select * From " & _ Me.lstLookupTables.SelectedItem.ToString, cnn) Dim ocbTableData As...
... compared to retrieving asingle value using an output parameter or using a DataReader, it allows asingle value to be returned with the least code and may therefore improve readability and maintainability ... ExecuteScalar( ) method of the Command object returns asingle value from the data source rather than a table or data stream While the ExecuteScalar( ) method does not result in a performance improvement ... and maintainability If the result set returns more than one result, the first column of the first row is returned as a scalar value A null reference is returned if the result setis empty or...
... lstLookupTables as the Select command for the modaLookupData data adapter The data table called dtData is then filled and set as the data source for dgTableData Listing 8.10 frmHowTo8_2.vb: Populating ... dtData As New DataTable() Try ' Update the data adapter and data table to reflect the new data, ' and reassign the data source of the data grid modaLookupData = New OleDb.OleDbDataAdapter("Select ... into a data adapter, which fills a data table This, in turn, is used for the data source of the data grid, and the data is displayed When the user clicks the button with the caption Update, a CommandBuilder...
... shall be measured and used to calculate an equivalent diameter, as if the cable were circular - NOTE For flat cables having a ratio of major to minor axis greater than 17:1, the flame application ... mm, lessai est considộrộ comme non satisfaisant Si un essai est enregistrộ comme non satisfaisant, deux autres essais sont effectuộs Si les rộsultats de ces deux essais sont satisfaisants, le ... non-governmental organizations liaising with the IEC also participate in this preparation The IEC collaborates closely with the International Organization for Standardization (ISO) in accordance with...
... chauffants de tension nominale 300/500 V pour le chauffage des locaux et la protection contre la formation de glace 811: -Méthodes d’essais communes pour les matériaux d’isolation et de gainage ... décrite dans l a Publicat i o n 332-1 d e la CE1 n'est pas adaptée, c a r certains conducteurs de faible section peuvent f o n d r e pendant l'application d e l a flamme I I est recommandé d'appliquer ... measure 600 f 25 mm Two such samples shall be available, designated and Conditioning before t e s t If t h e insulated w i r e has a paint o r lacquer f i n i s h t h e samples shall b e maintained...
... System.EventArgs e) { ds = new DataSet( ); // Create the DataAdapter SqlDataAdapter da = new SqlDataAdapter("SELECT * FROM " + TABLENAME, ConfigurationSettings.AppSettings["Sql_ConnectString"]); // Load ... schema and data for the table da.FillSchema(ds, SchemaType.Source, TABLENAME); da.Fill(ds, TABLENAME); // Columns in XML representation of data as attributes foreach(DataColumn col in ds.Tables[TABLENAME].Columns) ... // are available so that WriteXml( ) works DataSet dsChange = ds.GetChanges(DataRowState.Deleted); dsChange.RejectChanges( ); dsChange.WriteXml(sw, XmlWriteMode.WriteSchema); cmd.Parameters.Add("@datadelete",...
... splitters can be preinstalled or ordered separately ADC Fiber Distribution Hub – ACE-200 (576 Homes) Front of cabinet Rear of cabinet Base Cabinet Sizes Cabinet AFD ACE-100 ACE-200 ACE-400 Size ... specifications by contacting our headquarters office in Minneapolis ADC Telecommunications, Inc views its patent portfolio as an important corporate asset and vigorously enforces its patents Products ... ADC’s global sales office locations, please refer to our web site ADC Telecommunications, Inc., P.O Box 1101, Minneapolis, Minnesota USA 55440-1101 Specifications published here are current as...
... gcattGTCGACttttttgtaaatttttttggggttttttaaaagatttttttagattttttttg gattttttCTGCAGCAGAGCTCGTTTAGTGAACCG Ccttctccccggcggttagtgctgagagtgc aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa Primer ... PCMV-Sport–b-gal plasmid) CGCTATTACCATGGTGATGC (nucleotides 4588–4608 of PCMV-Sport–b-gal plasmid) CGGTTCACTAAACGAGCTCTGCTGCAGaaaaaatccaaaaaaaatctaaaaaaatcttttaaaa aaccccaaaaaaatttacaaaaaaGTCGACaatgc gcattGTCGACttttttgtaaatttttttggggttttttaaaagatttttttagattttttttg ... Journal compilation ª 2008 FEBS S Ma et al (1) β-gal CMV Transcription start site C β-gal (2) ARS-β-gal CMV Transcription start site β-gal AR S 5’-aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa-3’...
... FEBS A Parthasarthy and K P Gopinathan completely abolished when the TATATAA sequence was mutated to GATATCA (lanes 3, 4) These results were also consistent with the observation that TFIIIB alone ... tRNA1 -1 has asingle TATA element at )130 bp and is transcribed to the same levels as the parent pmutRKX3 has the single TATATAA element of Gly pRKX3 mutated to GATATCA tRNA1 -6,7 (in plasmid Gly ... Regulation of pol III transcription A Parthasarthy and K P Gopinathan and making them unavailable for transcription The ‘TATATAA’ sequence present in the flanking regions Gly of tRNA1 -6,7 was responsible...
... character is combined with existing partial candidates in all possible ways to generate new partial candidates An agenda is used to control the search space, keeping only the B best partial candidates ... Barcelona, Spain Adwait Ratnaparkhi 1996 A maximum entropy model for part-of-speech tagging In Proceedings of the EMNLP Conference, pages 133–142, Philadelphia, PA Murat Saraclar and Brian Roark ... Conference, pages 618–626, Sydney, Australia Tetsuji Nakagawa and Kiyotaka Uchimoto 2007 A hybrid approach to word segmentation and pos tagging In Proceedings of ACL Demo and Poster Session, pages 217–220,...
... snake (E quadrivirgata, E climacophora and A blomhoffii), amphibian (X laevis, Rana catesbeiana, Bufo vulgaris japonicus and Cynops pyrrhogaster), avian (chicken) and fish (O mossambicus) DNases I were ... enzymes (A) , and RT-PCR analysis of the total RNA from several tissues of E quadrivirgata (B) (A1 ) Purified DNase I (about lg) from human urine (lane 1), E quadrivirgata pancreas (lane 2), E climacophora ... obtained from the Japan Snake Institute, Gunma, Japan Phenyl Sepharose CL-4B, DEAE Sepharose CL-6B and Superdex 75 were purchased from Amersham Pharmacia Biotech; Concanavalin A (Con A) agarose...
... clinical activities other than epidural analgesia and cesarean anesthesia (including anesthesia for retained placenta and complicated vaginal deliveries, antenatal or pre-operative consultation, and ... coupling exists, as the OAAI is derived from both epidural rates and cesarean rates, it is precisely for this reason that this single denominator isa more reliable measure of activity than annual delivery ... numbers A limitation of the data upon which this secondary analysis is based is that data were selfreported and not corroborated; in almost all cases data were approximated by the unit directors Part...
... creates a dynamic habitat for aquatic fauna near the interface These organisms are part of a food chain that sustains a diverse ecological community Studies indicate that these organisms may ... example, recharge at the water table is equal to ground-water discharge to a stream (Figure C– 1A) Assume a well is installed and is pumped continually at a rate, Q1 After a new state of dynamic ... streams Evaporation generally has a greater effect on lake levels than on stream levels because the surface area of lakes is generally larger and less shaded than many reaches of streams, and...
... conformational changes in this motif The Ca2+ signal change and the accompanying conformational change in the canonical EF-hand are probably relayed to the SAM domain via the paired ‘hidden’ EF-hand, resulting ... reveals STIM1 surface exposure Proc Natl Acad Sci USA 104, 3693–3697 Zhang SL, Yu Y, Roos J, Kozak JA, Deerinck TJ, Ellisman MH, Stauderman KA & Cahalan MD (2005) STIM1 isa Ca2+ sensor that activates ... increased, indicating that the inserted EF-hand motif at least partially maintains the natural helical structure after grafting The Ca2+ dissociation constant of CD2.STIM1.EF (512 lm) is in good agreement...