ag al2o3 sample shows only the diffraction peaks of the alumina support figure 3 2 the absence of peaks due to silver is consistent with a small crystallite size below 4 nm at ag loading of 4 wt and higher diffr
Supported group II transition metal catalysts in liquid phase reactions using borrowing hydrogen methodology 1
... for wt % Ag/ Al2O3 (c) before and (d) after annealing Figure 3- 6 Al 2p XPS spectra of Al2O3 support and 10 wt % Ag/ Al2O3 catalyst after calcination in air and H2 pre-treatment for 30 Figure 3- 7 Ag ... Ag/ Al2O3 Figure 4 -3 XRD diffractograms (a) γ -Al2O3 and Ag/ Al2O3 with (b) 0 .29 (c) 0.59 (d) 1 .2 (e) 2. 4 (f) 6 .2 and (g) 13 wt % Ag Figure 4- 4 XRD diffractogram (i) commercial Al2 O3 (ii) 2. 4 wt ... Ag 3d XPS spectra of 10 wt % Ag/ Al2O3 after calcination in air and after H2 pre-treatment Figure 3- 8 O 1s XPS spectra of 10 wt % Ag/ Al2O3 after calcination in air and after H2 pre-treatment Figure...
- 221
- 658
- 0
Báo cáo khoa học: " Effect of the medical emergency team on long-term mortality following major surgery"
... patients, including rapid stabilization of vital parameters, physical and neurological examination, radiography and laboratory analysis Patients on catecholamines upon arrival showed clinical ... faecalis and faecium, C albicans, F solani, A fumigatus, P aeruginosa and MRSA from wounds, A baumanii, Alcaligenes xylooxidans, E faecalis and faecium, K pneumoniae, MRSA and S maltophilia from ... Thailand -disaster management in a district hospital N Engl J Med 20 05, 35 2: 9 62- 9 64 Available online http://ccforum.com/content/10 /2/ R50 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 ...
- 9
- 761
- 0
EFFECT OF THE NUMBER OF THE VERTICAL PIPES FOR THE PASSIVE AERATION ON THE COMPOSTING RATE
... Water content (g) Mixing ratio of the raw materials (-) 60 5.7 5.1 191 45 5 199 125 35 1 4 :2: 1 60 6.6 5 .3 185 44 1 166 2 93 551 3: 2: 1 60 10 .4 5 .2 186 4 43 181 25 2 39 3 3: 1:1 Experimental apparatus and ... composting operations, Waste Management & Research, 16 (5), 48 4 -48 9 Nakasaki, K., Kuratomi, H., Wakizaka, H., Hiyama, R and Akakura, R (1998b) Quantitative Analysis of Ammonia and Odorous Sulfur ... China, International Development Research Center (IDRC), Ottawa, IDRC-TS8e, 7- 13 Nagasaki K., Akakura N and Atsumi K (199 8a) Degradation Patterns of Organic Material in Batch and Fed-batch composting...
- 8
- 622
- 1
Effect of the presence of coexisting substances on UV inactivation of Cryptosporidium parvum oocysts
... low- and medium-pressure ultraviolet irradiation Wat Res., 37 , 35 17 -35 23 Yamamoto, N., Urabe, K., Takaoka, M., Nakazawa, K., Gotoh, A. , Haga, M., Fuchigami, H., Kimata, I and Iseki, M (20 00) ... was calculated by equation (2) : V (%) = S /4 IO + PO + EO (2) The survival ratio (Sr) was calculated from equation (3) : Sr = Va V0 (3) Where, Va is the excystation rate of the UV-irradiated sample ... 161-167 Morita S., Namikoshi A. , Hirata T., Oguma K., Katayama H., Ohgaki S., Motoyama N and Fujiwara M (20 02) Efficacy of UV irradiation in inactivating Cryptosporidium parvum oocysts Appl Environ...
- 8
- 358
- 0
Tài liệu Báo cáo "Effect of the preparation conditions on the properties of Fe-Pt nanoparticles produced by sonoelectrodeposition " pptx
... annealing the particle size increased to 10 – 25 nm due to the aggregation and particle growth In addition, the size distribution of the annealed particles was larger than that of the as-prepared samples ... was discovered as early as 1 9 34 that the application of ultrasonic energy could increase the rate of electrolytic water cleavage The effects of ultrasonic radiation on chemical reactions are due ... (left) and annealed (right) FePt nanoparticles (700°C/1 h) Figure is the TEM images of typical as-prepared and annealed samples Particle size of the asprepared FePt sample was – 10 nm After annealing...
- 7
- 513
- 0
Tài liệu Báo cáo khoa học: Salt-induced formation of the A-state of ferricytochrome c – effect of the anion charge on protein structure docx
... pronounced in the case of the K13N mutant), and the absorbances at 49 7 and 528 nm, in the visible region, are inverted, whereas the CT band is weakened and redshifted This indicates that the mutations ... of the A- state A- state stability Figure shows the thermal denaturation profiles of the A- state of cytochrome c, as obtained from ellipticity values at 22 2 nm As previously observed for mononvalent ... spectrum of acid-denatured cytochrome c (spectrum a of Fig 8A) displays an absorption maximum around 39 5 nm in the Soret region, and a maximum at 49 7 nm, a shoulder at 528 nm and a charge transfer...
- 11
- 487
- 0
The effect of grammar teaching (syntax) in English on 5 to 16 year olds’ accuracy and quality in written composition potx
... text and sentence to context and meaning Language awareness An approach to teaching about language that aims to raise awareness of different aspects of language, as opposed to formal grammar teaching ... ‘special grammatical materials’ of Bateman and Zidonis Second, the analytical framework of the two studies is different, with Elley et al using 12 variables for analysis and Bateman and Zidonis, 46 ... approach of these grammars is paradigmatic: that is, classes and categories of the language were defined, and these were then taught as a means to write the language In the Renaissance, the principle...
- 85
- 700
- 1
Gaza’s Children: FallinG Behind The eFFeCT oF The BloCkade on Child healTh in Gaza ppt
... years 1 ,2 73. 7 1, 930 .4 1, 838 .4 2, 0 42 . 2 1,985 .3 2, 0 84. 6 2, 1 64. 7 Bloody diarrhoea 6 43 830 .3 681 .3 49 1 .4 42 9 .5 37 0 2 63. 9 Viral hepatitis 59 .2 82. 7 59 .4 81 73. 1 37 .6 35 .9 Mumps 4. 5 11.1 4. 8 1.8 4. 1 ... savethechildren.org.uk Registered charity England and Wales (2 138 90) and Scotland (SC 039 570) Established in the aftermath of the massacre at Sabra and Shatila, MAP delivers health and medical care ... Palestinian territory”, 20 09; 37 3: 1 133 - 43 5 Gaza authorities. 23 Gaza’s health authorities gather information and develop strategies largely in isolation, without reference to wider national analysis...
- 32
- 425
- 0
Báo cáo Y học: Effect of the disease-causing mutations identified in human ribonuclease (RNase) H2 on the activities and stabilities of yeast RNase H2 and archaeal RNase HII pot
... substrate These oligomeric substrates were prepared by hybridizing lm of the 5¢-FAM-labeled 29 base DNA 13- RNA4-DNA 12 (5¢-AATA GAGAAAAAGaaaaAAGATGGCAAAG -3 ) and DNA15RNA1-DNA 13 (5¢-AATAGAGAAAAAGAAaAAAGATG ... 5¢-GGGGAAGCTTCTA GTGGTGGTGGTGGTGGTGCTTACGTTTAAAAAAT CCATC -3 for RNH2B-R; 5¢-ATATAAGCTTCTCTCAA GGAGATATACTTATGACCAAAGATGCCGTG -3 for RNH2C-F; and 5¢-GGAGCTCGAGTTAGTGGTGGTG GTGGTGGTGCTGATTTATGACATCGATGAGG -3 ... 5¢-ATTAT CATATGGGTACCCCCACGG -3 for RNH 2A- F; 5¢-TG TGGAATTCAGTGGTGGTGGTGGTGGTGCCGGTAC CAATTATCTAGGG -3 for RNH 2A- R; 5¢-ATATGAA TTCTCTCTAAGGAGATATACTTATGACCGTTTCCAA CATTGGG -3 for RNH2B-F; 5¢-GGGGAAGCTTCTA...
- 14
- 482
- 0
the effect of the hydrothermal treatment with aqueous naoh solution on the photocatalytic and photoelectrochemical propertiesof visible light-responsive TiO2thin films
... Yamaguchi, S Sato, J Chem Soc., Faraday Trans (81) (1985) 1 23 7 1 64 M Matsuoka et al / Catalysis Today 1 32 (20 08) 159–1 64 [6] S Tabata, H Nishida, Y Masaki, K Tabata, Catal Lett 34 (1995) 24 5 ... (a) Vis-TiO2/Ti and (b–d) NaOH(X)-Vis-TiO2/Ti 1 62 M Matsuoka et al / Catalysis Today 1 32 (20 08) 159–1 64 Table Surface areas of Vis-TiO2/Ti and NaOH(X)-Vis-TiO2/Ti Sample Abeta (cm2) Vis-TiO2/Ti ... Catal 35 (20 05) 30 5 [10] M Kitano, K Tsujimaru, M Anpo, Appl Catal A: Gen 31 4 (20 06) 179 [11] M Kitano, M Takeuchi, M Matsuoka, J.M Thomas, M Anpo, Catal Today 120 (20 07) 133 [ 12] M Matsuoka,...
- 6
- 489
- 0
effect of the market on construction of music manufactured b
... thousand girls are screaming at the boys on stage, some passing out from excitement and being taken away by the St John's Ambulance Brigade .To create an image, the managers put the word out that the ... England's next Mega-band would be in such and such a place at such and such a time They then turned up with the band in the designated places and times to allow the 'fans' to kiss or be kissed ... performance took place on the Smash Hits Tour, which, not surprisingly, was attended and practically consisted only of girls aged between 10 and 15!EvaluationFigure is a diagram which can be used to...
- 4
- 338
- 0
Gaza’s Children: FallinG Behind - The eFFeCT oF The BloCkade on Child health in Gaza ppt
... years 1 ,2 73. 7 1, 930 .4 1, 838 .4 2, 0 42 . 2 1,985 .3 2, 0 84. 6 2, 1 64. 7 Bloody diarrhoea 6 43 830 .3 681 .3 49 1 .4 42 9 .5 37 0 2 63. 9 Viral hepatitis 59 .2 82. 7 59 .4 81 73. 1 37 .6 35 .9 Mumps 4. 5 11.1 4. 8 1.8 4. 1 ... savethechildren.org.uk Registered charity England and Wales (2 138 90) and Scotland (SC 039 570) Established in the aftermath of the massacre at Sabra and Shatila, MAP delivers health and medical care ... Palestinian territory”, 20 09; 37 3: 1 133 - 43 5 Gaza authorities. 23 Gaza’s health authorities gather information and develop strategies largely in isolation, without reference to wider national analysis...
- 32
- 453
- 0
The Effect of the 2001 Tax Cut on Low- and Middle-Income Families and Children pdf
... 8 ,27 5 23 , 370 30 ,050 41 ,33 0 20 01 8,580 25 ,1 13 33, 825 48 ,29 4 20 03 8,580 25 ,811 33 , 8 34 47 , 040 Year 20 05 8,580 25 ,858 34 ,8 94 48,979 20 07 8,580 25 , 531 34 , 735 48 ,37 8 20 09 8,580 25 ,551 36 ,5 82 51 , 32 8 20 10 ... 23 , 26 0 31 , 027 42 , 506 Year 20 05 8,580 23 , 385 31 ,9 03 44 ,25 8 20 07 8,580 23 , 22 0 31 , 840 43 , 715 20 09 8,580 23 , 355 33 , 021 46 ,27 0 20 10 8,580 23 , 806 34 ,081 49 ,976 Notes and source: In calculating the year ... 20 01 -3, 687 -2, 797 695 3, 3 14 20 03 -3, 880 -2, 930 8 04 3, 42 4 20 05 -4, 456 -3, 25 7 6 63 3 ,2 83 20 10 -4, 601 -3, 837 127 2, 746 Source: Authors’ calculations Notes: Pretax income is defined as wages plus the...
- 49
- 425
- 0
Báo cáo khoa học: Effect of mutations at Glu160 and Val198 on the thermostability of lactate oxidase doc
... extension of the side-chain generated by the Val fi Ile mutation forms van der Waals contacts with the side-chain atoms of Thr 128 or the main-chain atoms of Gly 126 and Ala 127 As residues 126 – 128 are ... Minagawa et al (Eur J Biochem 27 0) specific activity of V198I lactate oxidase was approximately the same as that of wild-type lactate oxidase, and that of E160G/V198I mutant lactate oxidase was approximately ... factors averaged for the main-chain atoms of spinach glycolate oxidase [19] The data were obtained from the Protein Data Bank (entry ID: 1GOX) The average B-factor of each residue is plotted against...
- 6
- 512
- 0
Báo cáo khoa học: Analysis of the effect of potato carboxypeptidase inhibitor pro-sequence on the folding of the mature protein pot
... of both spectra indicate the lack of non-sequential interactions and, hence, the lack of a compact and defined fold The comparative analysis of 1H-NMR spectra of mature PCI and ProNtPCI indicates ... After h the sample was centrifuged at 30 00 g for 10 and the supernatant was dialyzed against 0.1 M Tris/HCl (pH 8.5) for 12 h and then renaturation was performed by dialysis in the presence of a redox ... chromatogram The elution position of each native or native-like form is indicated (N) In case of G35P/P36G mutants the disulfide pairing is not the same as wild-type PCI [22 ]; in these cases, S stands...
- 10
- 458
- 0
Báo cáo khoa học: Effect of the -Gly-3(S)-hydroxyprolyl-4(R)-hydroxyprolyltripeptide unit on the stability of collagen model peptides ppt
... mM The CD signal was monitored at 23 5 nm with a heating rate of °CÆh)1 decrease in the transition enthalpies The numerical data are given in Table Discussion and analyzed by CD at 23 5 nm with a ... position of the -Gly-Xaa-Yaa- collagen sequence has also been analyzed [ 23 , 27 ,28 ] Compared to the post-translational modification at the C4 position, the effect of 3- hydroxylation of prolyl residues ... acetyl-(Gly -3( S)Hyp -4( R)Hyp)10-NH2 CD spectra were measured at 4, 20 , 40 and 80 °C in water at a concentration of 100 lM The positive ellipticity at 22 5 nm decreases as the temperature is increased from to 20 , 40 ...
- 11
- 601
- 0
Báo cáo hóa học: " Effect of triplet multiple quantum well structures on the performance of blue phosphorescent organic light emitting diodes" potx
... resistance of 12 /sq The ITO was cleaned with acetone, methanol, distilled water, and isopropyl alcohol in an ultrasonic bath The pre-cleaned ITO was then treated with O2 plasma with the conditions of ... concentrations below ppm A desiccant material consisting of barium oxide powder was used to absorb the residue moisture and oxygen in the encapsulated device The devices had emission areas of × mm The ... with a quartz crystal monitor, and the doping concentrations of the emitters were optimized After the organic and metal depositions, the devices were encapsulated in a glove box with O2 and H2O at...
- 12
- 417
- 0
báo cáo hóa học: " Imaging the effect of receptor for advanced glycation endproducts on angiogenic response to hindlimb ischemia in diabetes" docx
... Femoral artery ligation Under isoflurane anesthesia, the hair on the abdominal wall and pelvis and both upper legs was shaved and the skin prepped with iodine and alcohol An incision was made on the ... we were able to show in live animals that in the absence of RAGE, the angiogenic response to ischemia is ameliorated both in diabetic and non-diabetic mice Diabetics have an attenuated angiogenic ... 0 . 34 (range, 1 .46 to 2. 79), and for the WT diabetic group, it was 1 .38 ± 0 .26 (range, 1.05 to 1. 74) (P < 0.001) (Figure 2A) The mean value for the RAGE-/- non-diabetic group was 2. 02 ± 0 .29 (range,...
- 9
- 398
- 0
Báo cáo hóa học: "Effect of the carbon nanotube surface characteristics on the conductivity and dielectric constant of carbon nanotube/poly(vinylidene fluoride) composites" doc
... temperature The samples were crystallized for 60 at 120 °C to ensure the evaporation of all DMF solvents After the crystallization process, the samples were heated until 23 0 °C and maintained at that ... of CO2 and CO obtained by integration of areas under TPD spectra Sample CNTs CNTox CNTox400 CNTox900 BET surface area (m /g) 25 4 400 4 32 44 9 pHPZC 7 .3 4 .2 6.9 7 .4 CO2 (μmol/g) 70 778 23 0 24 CO ... ’Carbon nanotubes and nanofibers in catalysis’ Appl Catal A 20 03, 2 53: 337 Carabineiro et al Nanoscale Research Letters 20 11, 6 :30 2 http://www.nanoscalereslett.com/content/6/1 /30 2 10 11 12 13...
- 5
- 353
- 0
Báo cáo hóa học: " Effect of the Nd content on the structural and photoluminescence properties of silicon-rich silicon dioxide thin film" pdf
... additional phases In the 27 - 32 ° range, it shows various sharp peaks that are located above a broad band Figure Evolutions of the positions of the LO3 and TO3 peaks, and the LO3 /TO3 intensity ratio, as ... of the Nd concentration centered at 29 ° This peak, and the 48 ° one, indicate the presence of nanocrystalline Si [21 ,25 ], while the sharp and intense peaks located at 27 .6°, 28 .8°, and 30 .7° are ... of non-radiative recombination channels It was demonstrated that the PL of Nd 3+ ions was quenched at high Nd-concentration (4. 9 at. %) because of the formation of Nd2O3 nanocrystals and the occurrence...
- 8
- 474
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008