administering medication via a dry powder inhaler

Báo cáo khoa học: "What do we know about medication errors made via a CPOE system versus those made via handwritten orders"

Ngày tải lên : 25/10/2012, 10:39

... physicians Also, the CPOE Shulman et al [1] examined included an available (but not interactive) on-line information system with drug interactions, contraindications, side effects, formulary, and IV administration ... Berger and Kichak [3] make the critical point that studies of prescribing errors overwhelmingly count errors that not affect patients We almost always count potential errors, not actual adverse ... emerge.” Evaluation of CPOE systems, and of all healthcare information technology, is mostly terra incognita This research reminds us that while CPOEs undoubtedly reduce several forms of medication...

2
524
1

Báo cáo khoa học: " Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit"

Ngày tải lên : 25/10/2012, 10:39

... involved in critically revising the draft JG made substantial contributions to the data analysis GB was substantially involved in the analysis, interpretation and drafting the manuscript Acknowledgements ... care unit JAMA 1999, 282:267-270 British Medical Association and the Royal Pharmaceutical Society of Great Britain: British National Formulary March edition London; 2003 National Coordinating Council ... patient outcome from each error were assigned by the pharmacist and the ICU clinical director, according to an adapted scale [9-11] Minor errors were classified as those causing no harm or an...

6
525
0

Building a dry stone wall

Ngày tải lên : 17/12/2013, 10:44

... stone can also be cut with a circular saw and carbide blade To break large fieldstones, use a sledgehammer Plan openings for walkways and gates in your wall before you begin work STEPS Stake out ... expensive than the other two, and gives your wall a more formal appearance The stoneyard will deliver your choice on wooden pallets a few days after you order it Dig a shallow foundation trench, about ... chisel and hammer can help It's best to lay one course at a time Vary the size of stones as you progress; follow a large stone with several smaller ones Use larger pieces at an end of the wall for...

4
149
0

Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

Ngày tải lên : 16/02/2014, 09:20

... AGTAAGGAAAATAAGCTTGGGCATGATCCC GCTCACTGCCTAAGCTTTGTAGCTAATAAAG CTTTATTAGCTACAAAGCTTAGGCAGTGAGC CTTTGTTATTTATTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAATAAATAACAAAG CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAAGCTTTAACAAAG ... SJS170 ALS030 SJS209 SJS275 SJS276 CGGAAGATCTAACTAAGCGTGCTGCTTC TACGAGATCTGTTGTTTGGAAGCAGGTT CGGAAGATCTGGGATCATGCCCATTTAG TACGAGATCTTAGCTACATTAAATAGGC GGGATCATGCCCAAGCTTATTTTCCTTACT AGTAAGGAAAATAAGCTTGGGCATGATCCC ... AACTCACCATAGGAATGCATAAGCTTTAACAAAG CCTCTTACACTTGCTTTTGAC GCAAAGGTGCCTTTGAGGTTG GACCCCTTCATTGACCTCAACTA CTTGATTTTGGAGGGATCTC TTAGCTACATTAAATAGGCAG GtaatacgactcactataGGGATCATGCCCATTTAG Forward (nt 1281–1298...

14
635
0

Tài liệu Báo cáo khoa học: Hypoxia downregulates farnesoid X receptor via a hypoxia-inducible factor-independent but p38 mitogen-activated protein kinase-dependent pathway doc

Ngày tải lên : 18/02/2014, 13:20

... [set 1, 5¢-TAGTCCAG TGTGGTGGAATTCTGC-3¢ (sense) and 5¢-AAAGCATC AGGTTCCTTCTTAAG-3¢ (antisense); set 2, 5¢-AACTTT GCTGGCCGCCGCCGCTGG-3¢ (sense) and 5¢-GGCAAC TAGAAGGCACAGTCGAGG-3¢ (anti-sense)] ... transactivation domain, instead, having a novel C-terminus with additional uncharacterized transactivation properties [22] Several researchers have already reported that hepatocellular hypoxia causes ... decreased farnesoid X receptor activity Gastroenterology 126, 756–764 ´ ´ 57 Alvarez L, Jara P, Sanchez-Sabate E, Hierro L, Larrauri J, Dı´ az MC, Camarena C, De la Vega A, Frauca E, ´ Lopez-Collazo...

14
414
0

Báo cáo khoa học: Mouse cytosolic sulfotransferase SULT2B1b interacts with cytoskeletal proteins via a proline⁄serine-rich C-terminus doc

Ngày tải lên : 06/03/2014, 22:21

... Yanagisawa K, Sakakibara Y, Suiko M, Takami Y, Nakayama T, Nakajima H, Takayanagi K, Natori Y & Liu M-C (1998) cDNA cloning, expression, and characterization of the human bifunctional ATP sulfurylase ... human sulfotransferase 2B1b: immunogenicity, subcellular localization, kinetic properties and phosphorylation Drug Metab Dispos 34, 1749–1755 14 Sakakibara Y, Yanagisawa K, Takami Y, Nakayama ... Sports, Science and Technology of Japan, Health and Sciences Research Grants (Toxicogenomics) from the Ministry of Health, Labor and Welfare of Japan (Y Sakakibara), Japan Foundation for Applied Enzymology...

8
266
0

Growth of amorphous silicon nanowires via a solid–liquid–solid mechanism

Ngày tải lên : 16/03/2014, 15:05

... nanowires as material for electrodes showed a capacity as high as times that of the ordinary material w13,14x By optimizing dopants, it is believed that the a- SiNW film thus prepared will find application ... of the sample provided direct evidence to support a- SiNW growth via an SLS mechanism Fig 3a shows a low-magnification cross-sectional SEM image It is visible that a layer of a- SiNWs with a thickness ... with the peak corresponding to Si Žb TEM image revealing that the SiNWs have a smooth morphology and average diameter of ca 40 nm The SAED pattern shown in the inset reveals a characteristic...

5
503
2

Controlled growth of oriented amorphous silicon nanowires via a solid–liquid–solid (SLS) mechanism

Ngày tải lên : 16/03/2014, 15:14

... speculated that the a- SiNWs may have potential applications such as rechargeable battery of high capacity with portable size, which is closely related to the surface e ects In fact, it was recently ... revealed that the lithium battery using SiNWs as electrode materials showed a capacity as high as times than that of the ordinary one [12] Fig (a) Low and (b) magniÿed cross-sectional SEM images ... select area electron di raction (SAED) revealed that SiNWs are completely amorphous Though the reason why the resultant nanowires are amorphous instead of being crystalline is not yet very clear,...

5
386
0

Báo cáo khoa học: Ras oncogene induces b-galactoside a2,6-sialyltransferase (ST6Gal I) via a RalGEF-mediated signal to its housekeeping promoter pptx

Ngày tải lên : 16/03/2014, 18:20

... as described [36] H-Ras exon sense: 5¢-CTGAG GAGCGATGACGGAAT-3¢, H-Ras exon antisense: 5¢-ACACACACAGGAAGCCCTCC-3¢, K-Ras exon sense: 5¢-CCTGCTGAAAATGACTGAAT-3¢, K-Ras exon antisense: 5¢-ATACACAAAGAAAGCCCTCC-3¢ ... (5¢-GGATGGCACCGGCAGACATG-3¢) and mst171 (5¢-CACAGAAATGGGATCAGGCC-3¢) Both human H-Ras and K-Ras cDNA were obtained from Cancer Research UK Human H-Ras cDNA probe was isolated from an EcoRI digestion of H-RasV12 ... N-linked to asparagine: enzymatic characterization of a Galb1,3(4)GlcNAc :a2 ,3-sialyltransferase and a Gal b1,4GlcNAc :a2 ,6–sialyltransferase from rat liver J Biol Chem 257, 13845–13853 25 Takashima, S.,...

12
369
0

nanoplates of snwo4 and snw3o9 prepared via a facile hydrothermal

Ngày tải lên : 20/03/2014, 13:05

... structure replication and application as a methane gas sensor, Adv Funct Mater 19 (2009) 653–661 [17] E Matijevic, Preparation and characterization of well deﬁned powders and their applications in ... and WO3 was heated in an argon atmosphere at 600 ◦ C for 15 h to obtain the sample 2.2 Characterizations X-ray diffraction (XRD) patterns were collected on a Bruker D8 Advance X-ray diffractometer ... molar ratio of W6+ to Sn2+ in the precursors Due to the high speciﬁc surface area, ␣-SnWO4 nanoplates show higher response toward H2 than that prepared via a solid-state reaction The as-prepared...

6
499
0

synthesis of one-dimensional sno2 nanorods via a hydrothermal technique

Ngày tải lên : 20/03/2014, 13:08

... nanorods Fig The XRD pattern of the SnO2 nanorods grown via the hydrothermal method room temperature on a Horiba Jobin Yvon LabRam IR system at a spatial resolution of mm Raman scattering was ... annealed for h at 370 1C There are Raman peaks at 475, 632, and 774 cmÀ1 in the Raman spectrum which are in agreement with those of a rutile SnO2 Fig (a) The TEM image of a SnO2 nanorod on a holey-carbon ... SEM, and Raman spectra The results from Raman spectra and XRD patterns demonstrate that the obtained nanorods have the single crystalline rutile structure of SnO2 The present process has the advantage...

4
568
0

synthesis of single-crystalline hollow b-feooh nanorods via a controlled

Ngày tải lên : 20/03/2014, 13:08

... precipitates were collected, and washed with anhydrous ethanol several times Finally, the product was dried at 60°C in air XRD measurements of the as-prepared sample were carried on a Japan Rigaku ... then transferred into a stainless autoclave with a PTFE (polytetraﬂuoroethylene) container of 25 ml and maintained at 180°C for 15 h Subsequently the autoclave was allowed to cool down naturally ... of the nanorods in Figure 2b It can be seen that b-FeOOH hollow nanorods have an average diameter of 20$30 nm and an aspect ratio above 3$4 Almost there is only one big cavity in each particle...

8
355
0

mcsa-mcse implementing & administering security in a microsoft windows server 2003 network self-paced training kit [exam 70-299]

Ngày tải lên : 25/03/2014, 11:50

... malicious attackers gain access to your network Password guessing, password cracking, and man-in-the-middle attacks all attempt to exploit weaknesses in an organization’s authentication strategy If an ... between problems caused by authentication and authorization Chapter Planning and Configuring an Authentication Strategy 1-5 ■ Design an authentication strategy that meets an organization’s security ... questions are also available on the companion CD as a practice test Informational Notes Several types of reader aids appear throughout the training kit Tip Contains methods of performing a task more...

900
2.6K
0

Báo cáo hóa học: " Preparation and thermal conductivity of CuO nanofluid via a wet chemical method" potx

Ngày tải lên : 21/06/2014, 05:20

... Lee et al.’s data, Das et al.’s data, and Liu et al.’s data [30-32], suggesting the potential application as heat transfer fluids 12 13 14 Conclusion A wet chemical method to synthesize stable ... horizontal tube Int J Heat Mass Transfer 2007, 50:4749-4753 Wu SY, Zhu SY, Zhang XR, Huang J: Preparation and melting/freezing characteristics of Cu/Paraffin nanofluid as phase-change material (PCM) ... Cite this article as: Zhu et al.: Preparation and thermal conductivity of CuO nanofluid via a wet chemical method Nanoscale Research Letters 2011 6:181 Submit your manuscript to a journal and beneﬁt...

6
274
0

Báo cáo hóa học: " Research Article Finding Common Solutions of a Variational Inequality, a General System of Variational Inequalities, and a Fixed-Point Problem via a Hybrid Extragradient Method" ppt

Ngày tải lên : 21/06/2014, 07:20

... generalized strongly nonlinear quasivariational inequalities,” Journal of Mathematical Analysis and Applications, vol 201, no 1, pp 180–194, 1996 13 L.-C Ceng, S Huang, and A Petrusel, “Weak convergence ... Verma, “Iterative algorithms and a new system of nonlinear quasivariational inequalities,” Advances in Nonlinear Variational Inequalities, vol 4, no 1, pp 117–124, 2001 29 L.-C Ceng, C Wang, and ... Yao, Y.-C Liou, and S M Kang, “Approach to common elements of variational inequality problems and ﬁxed point problems via a relaxed extragradient method,” Computers & Mathematics with Applications,...

22
356
0

Báo cáo sinh học: " Research Article Multiplicative Noise Removal via a Novel Variational Model" doc

Ngày tải lên : 21/06/2014, 16:20

... as data fitting term and the total variation seminorm as regularizer A variational model involving curvelet coefficients for cleaning multiplicative Gamma noise was considered in [23] As information ... carriers, all images are eventually perceived and interpreted by the human visual system As a result, many researchers have found that human vision psychology and psychophysics play an important ... processing based on the linear RGB color models can be classified into two categories—the channelby-channel approach and the vectorial approach Compared with the first approach, the second approach can...

16
225
0

Báo cáo hóa học: " The Periodic Instability of Diameter of ZnO Nanowires via a Self-oscillatory Mechanism" pptx

Ngày tải lên : 22/06/2014, 18:20

... Fundamental Research for Nanomaterials and Nanostructures (Grant No 2005CB623603) and Natural Science Foundation of Anhui(Grant No 070414196) References C.S Lao, P.X Gao, R.S Yang, Y Zhang, Y Dai, ... powders The alumina boat was then transferred into the center of the tube furnace Then, the chamber was heated up to 950 °C at a rate of 20 °C/ under a 200 sccm constant ﬂow Ar (2%O2 in Ar) and kept ... X-ray diffraction spectra (XRD) (Philips X’pert-PRO, Cu Ka X-ray diffraction pattern (Fig 1) shows that all diffraction peaks can be indexed to those of the hexagonal wurtzite phase of ZnO and...

4
223
0

POSITIVE PERIODIC SOLUTIONS FOR NONLINEAR DIFFERENCE EQUATIONS VIA A CONTINUATION THEOREM GEN-QIANG pptx

Ngày tải lên : 23/06/2014, 00:20

... Wang and S S Cheng 313 Here we will invoke a continuation theorem of Mawhin for obtaining such solutions More speciﬁcally, let X and Y be two Banach spaces and L : DomL ⊂ X → Y is a linear mapping ... following lemma is true (2.8) G.-Q Wang and S S Cheng 315 Lemma 2.2 The mapping L deﬁned by (2.3) L is a Fredholm mapping of index zero Next we recall that a subset S of a Banach space X is relatively ... Busenberg and K Cooke, Vertically Transmitted Diseases, Biomathematics, vol 23, SpringerVerlag, Berlin, 1993 L A V Carvalho and K L Cooke, A nonlinear equation with piecewise continuous argument,...

10
188
0

Báo cáo toán học: " Deformation of Chains via a Local Symmetric Group Action" pot

Ngày tải lên : 07/08/2014, 06:20

... to maximal chains in a poset P as P -chains We claim that any orbit may be embedded by a map φ into the lattice Z n in such a way Z that poset rank is encoded as sum of coordinates and P -chains ... If a chain-labelling λ induces a local Sn -action on the maximal chains of a poset, and the sequences labelling the maximal chains are all distinct, then λ is an S-labelling; in this case, Sn ... these arc labels gives an edge-labelled graph which still satisﬁes the above two conditions Hence, the two maximal chains with parking functions (a1 , , an) and (a1 , , ai+1 , ai, , an) have...

18
284
0

Báo cáo lâm nghiệp: "Climatic signiﬁcance of tree-ring width and intra-annual density ﬂuctuations in Pinus pinea from a dry" pdf

Ngày tải lên : 07/08/2014, 16:20

... growing season IADFs in teak have also been observed in association with insect defoliation [44] In southern Patagonia (Argentina), Masiokas and Villalba [40] noted that anomalously dry warm springs ... occurring mainly from late autumn to early spring (Fig 2) In the coastal area, the nearest meteorological station is Alcácer Sal, whereas for the inland area the closest stations are Beja and Mértola ... earlywood, latewood and tree-ring widths were higher in the inland area than in the coastal area (Tab I) Values of mean sensitivity and standard deviation were higher for latewood than for earlywood...

10
407
0