adding a new downloaded from gateway application
Báo cáo Y học: Identification and characterization of a new gene from Variovorax paradoxus Iso1 encoding N -acyl-D-amino acid amidohydrolase responsible for D-amino acid production pdf
... xylosoxydans ssp xylosoxydans A- 6 N-acylD-glutamate amidohydrolase; Alicaligenes faecalis-DA1: Alcaligenes faecalis DA1 N-acyl–D-amino acid amidohydrolase; V paradoxus Iso1: Variovorax paradoxus ... D-Aminoacylase European Patent 60,950,706 ,A2 22 Kubo, K., Ishikara, T & Fukagawa, Y (1980) Deacetylation of PS-5, a new beta-lactam compound II Separation and purification of L-amino acid acylase ... N-D-AAase, was also produced in the Escherichia coli, purified and characterized MATERIALS AND METHODS Bacterial strains, plasmids and conditions Variovorax paradoxus Iso1 was isolated from an...
- 11
- 656
- 0
Báo cáo khoa học: A new sulfurtransferase from the hyperthermophilic bacterium Aquifex aeolicus Being single is not so simple when temperature gets high potx
... the termination and initiation codons for panD and aq477, they appear to be organized as an operon panD encodes an aspartate decarboxylase which catalyses the decarboxilation of aspartate to produce ... single-domain rhodanese We puried and characterized a protein from A aeolicus annotated as a hypothetical protein In vitro, it catalyses the transfer of sulfane sulfur from thiosulfate to cyanide ... The Aq-477 amino acid loop presents the motif of the catalytic domain of thiosulfate cyanide sulfurtransferase (TST) which is distributed among bacteria, archaea and eukaryotes Aq-477 catalyses...
- 16
- 442
- 0
korten - agenda for a new economy; from phantom wealth to real wealth (2009)
... Obama on a New Economy agenda As I was working on that piece with Michael, YES! magazine editors Sarah van Gelder and Doug Pibel suggested I a piece for YES! that would speak to the bailout passed ... and nature and the special character of America as a middle-class democracy, free from the extremes of wealth and poverty that I was led to believe characterized the world’s less advanced nations ... building, renewable energy, community capital, zero-waste manufacturing, and independent retail I am a member of the BALLE governing board AMIBA has paid particular attention to giving local independent...
- 217
- 277
- 0
Extending past research in extra role behavior unleasing a new paradigm from the prism of knowledge sharing and whistleblowing
... performance appraisals and Machiavellinism has not been widely researched Machiavellians can be distinguished from impression managers Machiavellians tend to employ manipulative strategies in dealing ... important today because knowledge is supplanting land, labor, and capital as the primary source of competitive advantage, and as such the ability to create new knowledge as well as to share existing ... appointments with various companies in Mumbai, vide their contacts I take this opportunity to specially thank “Kakukaka”, Prashant, Kalpesh, Jyotiben, Yogita, Nikita, Harshit, Hemali, Kajal and...
- 217
- 492
- 0
Tài liệu tiếng anh Điện tử công suất mạch MERS A new AC current switch called MERS with low on state voltage IGBTs for renewable energy and power saving applications
... using the new IGBT have been performed for a wind power application and a variable frequency induction heating application It is shown that the losses in the wind power application can be reduced ... losses are comparatively high The relative losses for a real scale system have been estimated and also included in the figure By increasing the dc-link voltage, and as a result the no-load voltage ... already exist; however, MERS has advantages such as large operating range, simple control as well as good characteristics seen from a semiconductor perspective Further two promising applications...
- 8
- 888
- 1
Tài liệu Create a New SQL Server Database from Within Visual Studio .NET pptx
... create a new database, it does give you an idea of where you can see various databases in your system Now you will learn how to create a database in VS NET You can open the Create Database dialog ... right-click on the SQL Server instance to which you want to add the database-in this case, SHADRACH2-and then choose New Database Although both methods open the Create Database dialog box, the second method ... need to create a new database Click OK to complete the dialog box and create the new database How It Works Now you when you click on the plus sign for the new database, you will see branches in...
- 3
- 460
- 0
Tài liệu Create a New Table with Data from Existing Tables doc
... data adapter ' and fill the data table Dim odaResults As _ New OleDb.OleDbDataAdapter("Select * From MyProdAndCat", BuildCnnStr("(local)", "Northwind")) odaResults.Fill(dtResults) Catch excp As ... Storing the SQL Statement in the lblSQLString Label to Display and Use Later Private Sub frmHowTo6_7_Load(ByVal sender As System.Object, _ ByVal e As System.EventArgs) Handles MyBase.Load ' Build ... MessageBox.Show(excp.Message) Exit Sub End Try ' Assign the data table to the data grid's DataSource property Me.dgResults.DataSource = dtResults End Sub Figure 6.8 These results are based on a...
- 4
- 376
- 0
Tài liệu Báo cáo " A new natural source of Camphor from Cinnamomum longepetiolatum Costerm. apud Phamh. in Vietnam " doc
... Preparation Flora of China Vol (Berberidaceae through Capparaceae) Science Press, Beijing, and Missouri Botanical Garden Press, St Louis [3] Vietnamese Pharmacopoeia, Medical Publishing House, Hanoi, ... 0.25 µm) The analytical condition were the same as described above with He as carrier gas, and interface temperature 260o C Components identification was carried out by comparing MS data with those ... phytochemical works have been recorded for the C longepetiolatum Costerm apud Phamh found in Vietnam As a part of the research on the essential oils of Medicinal and Aromatic plants of the Vietnam flora,...
- 4
- 403
- 0
Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx
... 757–778 AAG AGC GCA ACT GAT AGT GCA TCC GCC ATC GAC GCA ATT AGC CTT GCT AGC AGT ACG AGG 613–630 822–839 706–723 466–483 AAG AGC AAA GAT GAT AGT GAT TAC GCC ATC CCA CAG ATT AGC ATC AAT AGC AGT CAG ... purpureus and F scutaria larvae sequences have a H64 also shared by A gambiae, A aegypti, T gigas, D melanogaster-2 and D melanogaster-3 sequences (data not shown) By contrast, R pachyptila amino acid ... cnidarian F scutaria Finally, we chose an outgroup comprising a- CAs from a cyanobacteria (Nostoc sp.) and three proteobacteria (Klebsiella pneumoniae, Erwinia carotovora ssp atroseptica and Neisseria...
- 14
- 591
- 0
Báo cáo khoa học: A new phospholipase A2 isolated from the sea anemone Urticina crassicornis – its primary structure and phylogenetic classification pptx
... taipan snake Oxyuranus scutellatus (Os), and the boar Sus scrofa (Ss) Identical residues are on a black background, and similar residues are on a gray background The sea anemone unique asparagine ... isolated protein and the UcPLA2 cDNA are probably due to intraspecific variability, as mRNA was obtained from a single animal, whereas the protein was isolated from exudates of several U crassicornis ... Urticina crassicornis A Razpotnik et al A B Fig (A) Alignment of PLA2 protein sequences from: the sea anemones Urticina crassicornis (Uc), Nematostella vectensis (Nv) and Adamsia carciniopados (Ac),...
- 13
- 462
- 0
Báo cáo khóa học: A new UV-B absorbing mycosporine with photo protective activity from the lichenized ascomycete Collema cristatum docx
... were harvested immediately following irradiation and analysed for pyrimidine dimer formation Non-irradiated cells and cells irradiated through a naked quartz plate served as controls As can be ... in cyanobacteria Cells with high concentrations of MAAs are approximately 25% more resistant to UV radiation centered at 320 nm than those with no or low concentrations of MAAs [25] MAAs have ... amino-alcohol [11] In contrast, MAAs are UV absorbing metabolites of algae that contain an aminocyclohexenimine ring system, with UV absorption maxima between 310 and 360 nm To date, 17 different aminocyclohexenimines...
- 5
- 450
- 0
Báo cáo khoa học: A new clan of CBM families based on bioinformatics of starch-binding domains from families CBM20 and CBM21 potx
... Fig.2) amyAspka a- amylase amyAspnd a- amylase amyBacsp a- amylase amyCrysp a- amylase amyStrgr a- amylase amyStrlm a- amylase amyStrli1 a- amylase amyStrli2 a- amylase amyStrvi a- amylase amyThncu a- amylase ... 2.4.1.19 AAP31242 AAB65420 CAA55023 CAA48401 AAG31622 BAB91217 CAA33763 AAA22298 P31835 BAA14289 AAA22308 ALBSX1 AAA22310 AAA22309 CAA46901 BAA31539 AAA22239 CAA01436 Z34466 BAA02380 CAA41770 AAD00555 ... emersonii Aspergillus awamori Aspergillus niger T21 Neurospora crassa AAB02927 AAT58037 BAA00331 AAB59296 AAB20818 BAA01254 L15383 BAA08436 CAA47945 AAA33386 AAF75523 AAE15056 AAR61398 BAD06004 AAP04499...
- 17
- 476
- 0
Báo cáo khoa học: Purification and properties of a new S-adenosyl-Lmethionine:flavonoid 4¢-O-methyltransferase from carnation (Dianthus caryophyllus L.) pot
... molecular mass markers are indicated in kDa F 4¢-OMT activity towards the different assayed substrates, transformation products and kinetic analysis The enzyme became inactive when the assayed substrates ... of a specific methylated flavonoid phytoalexin, just as reported to occur in barley [28] In several plants, an accumulation of methylated flavonoids has been explained as a protection against pathogens, ... Plant Pathol 91, 119–135 14 Benavente-Garcia, O., Castillo, J., Sabater, F & Del Rio, J .A (1997) 4¢-O-methyltransferase from Citrus A comparative study in Citrus aurantium, Citrus paradisi and...
- 10
- 624
- 0
Báo cáo khoa học: GHP, a new c-type green heme protein from Halochromatium salexigens and other proteobacteria potx
... pseudomonads Eur J Biochem 236, 689–696 Caumette P, Baulaigue R & Matheron R (1988) Characterization of Chromatium salexigens Sp-Nov, a halophilic chromatiaceae isolated from mediterranean salinas ... G75, by ammonium sulfate precipitation (50–70% saturation), and by chromatography on hydroxyapatite, where it was eluted at 25 mm phosphate from a 0–100 mm gradient Final purification was achieved ... receptor-like PTP-alpha revealed by an antibody against oxidized protein tyrosine phosphatases Proc Natl Acad Sci USA 101, 1886–1891 Tsujimura M, Dohmae N, Odaka M, Chijimatsu M, Takio K, Yohda M, Hoshino...
- 11
- 517
- 0
Báo cáo Y học: Molecular cloning and characterization of isomultiflorenol synthase, a new triterpene synthase from Luffa cylindrica, involved in biosynthesis of bryonolic acid ppt
... b-amyrin synthase [6], was prepared by PCR using GgbAS1 as a template, Taq DNA polymerase (Takara Shuzo, Kyoto, Japan), the primers 50 -GAAGCATA TCCACTATGAAGATGA-30 and 50 -TGAATACTCCCGTG ATTTCCTGTTG-30 ... Nishinomiya, Japan) Other chemicals were purchased from Wako Pure Chemicals (Osaka, Japan) and Nakalai Tesque (Kyoto, Japan) Customized oligonucleotide primers were synthesized by Amersham Pharmacia ... cells by guanidine thiocyanate/hot phenol extraction [24] Poly (A) -rich RNA was purified by an mRNA purification kit (Pharmacia), and a Luffa cDNA library was constructed using a lZAP-cDNA synthesis...
- 7
- 491
- 1
Báo cáo khoa học: Cloning, expression and characterization of a new aspartate aminotransferase from Bacillus subtilis B3 docx
... GGCGCGACGCACGAAAATTACGC GTCTATTTTCACGCAAAGCACCCGGT AAACCGATTTGTACATCGCATTTTC CATTAATGGATATCGTTCCGATTCC firmed by sequencing (Invitrogen Biotechnology Co., Ltd, Shanghai, China) (Otsu, Japan) The ... Multispecific aspartate and aromatic amino acid aminotransferases in Escherichia coli J Biol Chem 250, 4128–4133 38 Yagi T, Kagamiyama H, Nozaki M & Soda K (1985) Glutamate-aspartate transaminase from ... necessary to form lmolÆmin)1 of oxaloacetate The aromatic amino acid aminotransferases were assayed according to Mavrides and Orr [37] The assay was established for AAT except that aspartate was...
- 13
- 490
- 0
A new system to remove cd from contaminated aqueous medium
... regenerated biomass of C sorokiniana was reusable having sorption efficiency of 98.3% C sorokiniana immobilized on lu a sponge, as a compact immobilized biomatrix Aloysius, R., Karim, M.I .A. , Ariff, A. B., ... the availability of which reduces, becoming a limiting factor at saturation (de Rome and Gadd, 1987; Rai and Mallick, 1992) Equilibrium sorption isotherms for free and immobilized algal biomass ... cells: application potential of vegetable sponge in microbial biotechnology Lett Appl Microbiol 17, 289–291 Rai, L.C., Mallick, N., 1992 Removal and assessment of toxicity of Cu and Fe to Anabaena...
- 3
- 467
- 0
Báo cáo khoa học: Sequences and structural organization of phospholipase A2 genes from Vipera aspis aspis, V. aspis zinnikeri and Vipera berus berus venom Identification of the origin of a new viper population based on ammodytin I1 heterogeneity docx
... CAGGAAACAGCTATGAC CGGAATTCTGAAGGTGGCCCGCC AGGTGACAG CGCGGATCCAATCTTGATGGGGC AGCCGGAGAGG AGGAYTCTCTGGATAGTGG CTCACCACAGACGATWTCC CGGTAAGCCCATAACGCCCA CAGGCCAGGATTTGCAGCC CATAAACAYGAGCCAGTTGCC GAGTGGATGCACAGTCGTTG ... GAGTGGATGCACAGTCGTTG GAAACGGAGGTAGTGACACAT GCCTGCTCGAATTCGGGATG CTCCTTCTTGCACAAAAAGTG CTGCTCGAATTCGGGATG GTCYGGGTAATTCCTATATA GTGATCGAATTTGGGAAGATGATCCA CCCTTGCATTTAAACCTCAGGTACAC a Specific primers ... 667–674 239 CAGCTgtaag/tccagGTCTG A B C D 163 243 671 261 CAGCTgtaag/tccagGTCTG GGGCGgtgag/tccagTTGAA AGGCGgtgag/caaagCTGAA GACCGgtaag/tccagCTGCT CTGTGgtgag/tgcagGAGGC (110) GACCGgtaag/tccagCTGCT...
- 10
- 451
- 0
Báo cáo khoa học: Characterization of scorpion a-like toxin group using two new toxins from the scorpion Leiurus quinquestriatus hebraeus doc
... not affect the brain Na channel Nav1.2 (in contrast to the antimammal a- toxins), they are most active on the cardiac Na channel subtype (more than the antimammal and anti-insect a- toxins, Lqh2 and ... pharmacological and structural arguments, and used a comparative approach to discuss the features that differentiate this type of toxins from classical- and antiinsect a- toxins Long ignored as ... labeled Lqh2 or Aah2 to rat brain synaptosomes (Fig 6) For antimammal and anti-insect a- toxins, the data points showing the relationship between LD50 and Ki values appear roughly aligned on a...
- 14
- 380
- 0
Đề tài " A new application of random matrices: Ext(C red(F2)) is not a group " ppt
... operators in Asa and Bsa , respectively Assume that for all m ∈ N and all matrices 715 A NEW APPLICATION OF RANDOM MATRICES a0 , , ar in Mm (C)sa , we have sp a0 ⊗ B + r i=1 r i=1 ⊗ yi ⊆ sp a0 ... separable unital nuclear C ∗ -algebra and by Voiculescu [V1], Ext (A) is a unital semi-group for all separable unital C ∗ -algebras A Anderson [An] provided in 1978 the first example of a unital ... example of a C ∗ -algebra A for which Ext (A) is not a group Introduction A random matrix X is a matrix whose entries are real or complex random variables on a probability space (Ω, F, P ) As in [T],...
- 66
- 378
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25