adaptive restoration a strategic approach for integrating research into restoration projects
Báo cáo hóa học: " Research Article A Practical Approach for Simultaneous Estimation of Light Source Position, Scene Structure, and Blind Restoration Using Photometric Observations" pot
... surface gradients and the albedo and also perform blind image restoration The surface gradients and the albedo are modeled as separate Markov random fields (MRFs), and a suitable regularization scheme ... reached It may be mentioned here that p, q are all matrices γm and τm are real values corresponding to a particular source position and σ is also a real value As already mentioned, we use the albedo ... labels for estimating the same was chosen as 10 Figures 7 (a) and S Sharma and ManjunathV Joshi (a) (b) (c) Figure 8: Depth map for vase (a) ground truth and obtained using (b) LS approach on...
- 12
- 379
- 0
Báo cáo khoa học: "A PARAMETERIZED APPROACH TO INTEGRATING ASPECT WITH LEXICAL-SEMANTICS FOR MACHINE TRANSLATION" doc
... 263 Aspectual Category(s) (ACC) (ACC ACT) (ACC ACT) (ACC) ~ACC ACT) (STA A C C A C T ACH) (STA A C C A C T A C H ) (ACC ACT STA) (ACC) (ACC) ~ACC ACT) ~ACC) ~ACC) (ACC ACT) {ACC) ( ACC ACT) {ACC ... Maria Juan le dio una pufialada a Maria Juan h a b f a i d o a la tienda euando Maria lleg6 Juan habia ido a la tienda al Ilegar Maria Sentence (9)(i) is an acceptable translation of (7)(it), but ... ACC ACT) {ACC ACT) {ACC ACT STA) (ACH ACT ACC ( ACC ACT) ) (STA ACC ACT ACH) (A C T ACC) (ACC) (ACC) (STA ACC ACT ACH) ~STA ACC ACT ACH) (ACC ACT) Figure 9: Aspectual Classification Results whether...
- 8
- 441
- 0
Báo cáo hóa học: "Research Article A Decentralized Approach for Nonlinear Prediction of Time Series Data in Sensor Networks" pptx
... other hand, a small value for ν will result in a large model order This will lead to a small approximation error, at the price of high computational load for updating the model at each sensor, and ... from lack of real system deployments and available data experiments Researchers often evaluate their algorithms and protocols with model-driven data [38] Here, we consider a classical application ... however, each sensor must know the locations of the other sensors This unfortunately imposes a substantial demand for both storage and computational time, as most practical applications require a large...
- 12
- 531
- 0
Báo cáo y học: "Galaxy: a comprehensive approach for supporting accessible, reproducible, and transparent computational research in the life sciences" ppsx
... computational analyses, systematically repeating analyses, capturing all details of performed analyses, and annotating analyses Using Galaxy Pages, researchers can communicate all components of an ... difference between Galaxy and GenePattern is each platform’s approach for integrating analyses and publications Galaxy employs a web-based approach and enables users to create Pages, web-accessible documents ... editors for tagging and annotations are integrated into Galaxy’s analysis workspace and are designed to support web-based genomic research Galaxy tags are hierarchical and can have values, and these...
- 13
- 400
- 0
CGrand Challenges: A Strategic Plan for Bridge Engineering
... of statistical databases for LRFD calibration, e.g maintenance, operations and geotechnical databases Development of performance standards for security Completion and adoption state-of-the-art ... professional training (including practices, materials and policies) Development of educational materials (materials appropriate to undergraduate education as opposed to available professional education ... be warranted Additionally, there are areas of the specification that are currently undergoing major revision A new conditional evaluation manual including the load and resistance factor rating...
- 21
- 1,073
- 0
a decentralized approach for implementing identity management in cloud computing
... a hybrid misuse-anomaly detection approach to take advantage of anomaly detection’s ability to detect new attacks, but without the approach s accompanying high rate of false positives There are ... for IdM, Privacy and Identity Management for Europe (PRIME), Windows CardSpace, and OpenID Also they propose an entity-centric approach for IdM in the cloud that based on active bundles and anonymous ... anomaly behavior or not As demonstrated in [11], a basic assumption of anomaly detection is that attacks differ from normal behavior But the definition of what’s normal and what’s abnormal is ambiguous...
- 7
- 589
- 0
Listening to Patients A Phenomenological Approach to Nursing Research and Practice
... role socialization, and cultural heritage are valued We are Christians and Jews, Appalachians and Easterners, Black and White, men and women, young and old, graduate students and faculty All contribute ... be an adequate word for the radical transformations that must take place in our healing practices Learning about existential phenomenology can be profoundly transformational, as our students and ... the American Nurses Association, the American Psychological Association, and Sigma Theta Tau International She is a board member of the International Council on Women's Health Issues and a charter...
- 309
- 398
- 0
Tài liệu Focusing Resources on Effective School Health: A FRESH Approach for Achieving Education for All doc
... the Dakar Framework for Action during the World Education Forum (Dakar, 2000) are revitalising efforts to achieve Education for All In developing National Action Plans to achieve the goals and ... community, and take advantage of a skilled workforce (teachers and administrators) that is already engaged with individual and organisational partners in the local community As students become healthier, ... planners, administrators and teachers, at the local as well as national level, can participate in and benefit from this exchange 11 Systematically monitor progress towards EFA goals and strategies at...
- 30
- 417
- 0
Tài liệu A Strategic Approach to Cost Reduction in Banking - Achieving High Performance in Uncertain Times docx
... program initiatives1 As Figure shows, a tactical cost-cutting approach will quickly yield substantial savings which rapidly level off after the first year A bank taking a more strategic, transformational ... strategy By examining a bank’s cost anatomy against these attributes, the opportunities and scale for cost reduction initiatives can be mapped across the entire organization Accenture’s approach ... business cases The third step is creation of the road map The cost/benefit outcome and approach for each initiative are finalized and sequenced into an implementation road map with a balanced portfolio...
- 16
- 508
- 0
Tài liệu Design for Sustainability a practical approach for Developing Economies doc
... Ethiopia Mr B.S Samarasiri, Moratuwa University, Sri Lanka Prof Dr John Turyagyanda, Makerere University, Uganda Dr Sonia Valdivia, UNEP DTIE, France Design and lay-out Ms Ana Mestre and Ms Gra a Campelo, ... Austria Mr Samantha Kumarasena, NCPC, Sri Lanka Mr Nguyen Hong Long, NCPC,Vietnam Ms Sophie Loran, UNEP DTIE, France Dr Diego Masera, UNEP Regional Office for Latin America and the Carribbean, ... spread as seen in the number of manuals and sectorspecific supporting materials that are available in many languages As a result, and based on experience, Ecodesign has evolved to encompass broader...
- 128
- 514
- 0
A Strategic Approach to Joint Officer Management ppt
... high standards for research quality and objectivity A Strategic Approach to Joint Officer Management Analysis and Modeling Results Margaret C Harrell, Harry J Thie, Sheila Nataraj Kirby, Al Crego, ... investigators are Harry Thie and Margaret Harrell Comments are welcome and may be addressed to Harry Thie at harry_thie @rand.org and to Margaret Harrell at margaret_harrell@rand.org For more information ... Monica, Calif.: RAND Corporation, MG-306-OSD, 2005 Harry J Thie, Margaret C Harrell, Sheila Nataraj Kirby, Al Crego, Roland J Yardley, and Sonia Nagda, Framing a Strategic Approach for Reserve Component...
- 249
- 403
- 0
Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf
... localization of cathepsin E and cathepsin D in human gastric cells and various rat cells J Biochem (Tokyo) 110, 956–964 Tsukuba T, Hori H, Azuma T, Takahashi T, Taggart RT, Akamine A, Ezaki M, Nakanishi ... Tsukuba T, Yamamoto S, Yanagawa M, Okamoto K, Okamoto Y, Nakayama KI, Kadowaki T & Yamamoto K (2006) Cathepsin E-deficient mice show increased susceptibility to bacterial infection associated with ... Hayakumo T & Nakajima M (1996) Expression of cathepsin E in pancreas: a possible tumor marker for pancreas, a preliminary report Int J Cancer 67, 492–497 22 Uno K, Azuma T, Nakajima M, Yasuda...
- 12
- 645
- 0
A Manual for Integrating Gender Into Reproductive Health and HIV Programs: FROM COMMITMENT TO ACTION pptx
... sex-disaggregated micro- and macro-economic data and national statistics on social development Information about labor force participation and segmentation, incomes, poverty rates, educational attainment, ... implement, and enforce human rights norms relevant to reproductive health In addition, a human and reproductive rights approach informs a gender-integrated approach to policy formulation and reform, research, ... released an RFP/RFA Guide and this Manual complements it Programs that use approaches like the one described in this Manual will have a strategic advantage Intended Audience The primary audience for...
- 71
- 608
- 0
Working PaPer SerieS no 1150 / January 2010: Do bank loanS anD creDit StanDarDS have an effect on outPut? a Panel aPProach for the euro area doc
... 8765 Bank of Albania, Sheshi “Skënderbej”, No.1 Tirana, Albania; e-mail: kadareja@yahoo.com © European Central Bank, 2010 Address Kaiserstrasse 29 60311 Frankfurt am Main, Germany Postal address ... N G PA P E R S E R I E S N O 115 / J A N U A RY 2010 DO BANK LOANS AND CREDIT STANDARDS HAVE AN EFFECT ON OUTPUT? A PANEL APPROACH FOR THE EURO AREA by Lorenzo Cappiello 2, Arjan Kadareja 3, ... Gambacorta, L and Marqués-Ibañez, D (2008), "Securitisation and the bank lending channel", European Economic Review (forthcoming) [3] Altunbas, Y., Gambacorta, L and Marqués-Ibañex (2009), "Bank...
- 30
- 911
- 0
A Conceptual Approach for Cannibalism Between Goods pot
... estudo exploratório dos fatores de marketing que contribuem para a sua ocorrência em indústrias alimentícias paulistanas (Dissertation: Master in Administração) Mackenzie, São Paulo (in Portuguese) ... greater risk the last one Currently, presumed private label brands account for a significant share of sales of retailers, particularly in the area of food The growth in size and share of own brands ... organizations that can cause cannibalism without benefits These instances related to top management decisions or the management practices of their products that include: a) strong top management...
- 5
- 366
- 0
Báo cáo khoa học: The competitor-introduced Gc recruitment system, a new approach for screening affinity-enhanced proteins doc
... and pLMZ-K3 5A- H using 50-nucleotide primers containing a region homologous to that directly upstream of PHOP2 (5¢-ATACAATTAATTGACATCAGCAGACAGCAAAT GCACTTGATATACGCAGCTCGACTACGTCGTAAG GCCG-3¢ and ... DNA using primers 5¢-AAAAGCGGCCGCTTAAAGCAAGGGTAA ATT-3¢ and 5¢-TTTTGAGCTCATCTTTCAAATAGAGC CTGG -3¢, and inserted into the NotI–SacI site of pLMZ -WT and pLMZ-K3 5A, yielding plasmids pLMZ-WT-H and ... The fragments encoding Z variants were amplified from pUMZ-WT and pUMZ-K3 5A [7] using primers 5¢-TTTTGTCGACATGGCGCAACACGA TGAAGCCGTAGACAAC-3¢ and 5¢-AAAAGGATCCTT ATTTCGGCGCCTGAGCAT-3¢, and inserted...
- 9
- 356
- 0
Báo cáo khoa học: "A Clustering Approach for the Nearly Unsupervised Recognition of Nonliteral Language" pdf
... the average of literal and nonliteral precision; similarly for average recall For overall performance, we take the f-score of average precision and average recall We calculated two baselines for ... the case of a larger scale annotation effort, having the person leading the effort provide one or two examples of literal and nonliteral usages for each target verb to each annotator would almost ... feature lists SuperTags (Bangalore & Joshi, 1999) encode a great deal of syntactic information in a single tag (each tag is an elementary tree from the XTAG English Tree Adjoining Grammar) In addition...
- 8
- 447
- 0
A Manual for Integrating Gender Into Reproductive Health and HIV Programs: From Commitment to ACtion (2nd edition) ppt
... Manual include RH program managers and technical staff of USAID and its implementing partners, as well as governmental organizations (GOs), and international and local nongovernmental organizations ... information identified in different domains that may facilitate Table 4.1 A Framework for Gender Analysis (Data Collection and Analysis) DATA COLLECTION AND SYNTHESIS-Step I DATA COLLECTION AND ... Case Studies as a Training Tool The Gender Continuum was actually developed as a training tool and this Manual can be easily adapted to such use Trainers might ask participants to place the case...
- 88
- 544
- 0
báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx
... 85(3):221-228 Tateishi-Yuyama E, Matsubara H, Murohara T, Ikeda U, Shintani S, Masaki H, Amano K, Kishimoto Y, Yoshimoto K, Akashi H, Shimada K, Iwasaka T, Imaizumi T: Therapeutic angiogenesis for patients ... human bone marrow Proc Natl Acad Sci USA 2000, 97(7):3213-3218 Kawada H, Fujita J, Kinjo K, Matsuzaki Y, Tsuma M, Miyatake H, Muguruma Y, Tsuboi K, Itabashi Y, Ikeda Y, Ogawa S, Okano H, Hotta ... stemcell-based products may originate in academic laboratories where researchers are unfamiliar with the applicable regulations As new stem-cell-based therapies are developed, the regulatory framework...
- 9
- 773
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25