... 1400 Alcohols I (analysis of acetone and ethanol by gas chromatography) NIOSH Manual of Analytical Methods, Volume (August 1994) 2.10 Gas Chromatography/Mass Spectrometry forVolatile Organics (analysis ... EPA Method 602: Purgable Aromatics, 40 CFR 136 Appendix A, Method forOrganic Chemical Analysis of Municipal and Industrial Wastewater (January 2008) 2.28 US EPA Method 625: Base/Neutrals and Acids, ... and Materials (ASTM) International, National Institute for Occupational Safety and Health (NIOSH), and United States Environmental Protection Agency (US EPA) analytical test methods: 2.1 ASTM...
... conditions Grape juice analyses The yeast strain used was a commercial active dried preparation of VL3 (Laffort Australia, Woodville, SA, Australia) ADY were rehydrated with water or water supplemented ... correction for multiple testing To validate the results, five differentially AGATGGCTTAGATGGCTTC TDH3 GCTGCCGCTGAAGGTAAG CGAAGATGGAAGAGTGAGAGTC OPT1 TGTCCCGATTGGTGGTATTTAC MET10 CACTCACGTTCCATCCACTACC ... (Statagene, Agilent Technologies, Santa Clara, CA) and oligo-dT20 primers by incubation for at 42°C and 15 at 55°C with heat inactivation for at 95°C Transcription analyses Transcription analysis...
... the air layer and the water layer CAir AIR Mixed Air Air-phase Boundary Layer Water- phase Boundary Layer WATER CWater Mixed Water Figure 2.4 Classical two-layer model ofa gas-liquid interface ... used for quantifying SVOCs in both gaseous and particulate samples o Chapter 5: Levels, Temporal, and Seasonal Trends of Semi -Volatile Organic Contaminants In Ambient Air and Rainwater In Singapore ... industrial transformer and capacitors In addition, PCBs were also used as plasticizers in sealants, caulkings, synthetic resins, rubbers, paints, waxes and asphalts, andas surface coatings for carbonless...
... naturally in petroleum and coal tar and is formed during forest fires Xylene is used asa solvent and in the printing, rubber, and leather industries It is used asa cleaning agent anda thinner for ... as cigarette smoke and automobile exhaust Route of exposure Styrene can be found in air, soil, andwater after release from the manufacture, use, and disposal of styrene-based products It evaporates ... Tetrachloroethylene, also known as perchloroethylene, is a human-made chemical that is widely used for dry cleaning of fabrics andfor metal-degreasing operations It is also used asa starting material...
... random data series, r; (d) the magnitude spectrum of random data series, mfr influencing factors such as wind speed, temperature, and weekday/weekend factors, so with ME an expanded factor analysis ... estimate the measurement uncertainty from the measurement series are as follows: (a) Generate a random series r with the same length as c (7292 elements) and variance νr2 ) (b) Perform FFT on c and ... FIGURE Sampling site (La Porte Municipal Airport) in Houston, Texas (e) Select the same range in mfr, and calculate the mean value of this range and name it m_mfr Actually, it is also feasible...
... PNNL DFGAS TOGA TOGA TOGA TOGA TOGA TOGA TOGA TOGA NCAR UCI IMK-IFU Texas A& M IMK-IFU NOAA PNNL Texas A& M NOAA PNNL Texas A& M Texas A& M NOAA NOAA PNNL PNNL UCI UCI UCI UCI BNL Additional measurements ... measurements from T0 and T1, sites that were heavily instrumented for tracegas analysis as well as from the DOE G1 aircraft, which repeatedly sampled MCMA air aloft, and the NCAR C130 aircraft ... toluene, and C8 and C9 aromatics, as well as the more polar species acetic acid and hydroxyacetone The measurement frequency was variable but the suite of measurements was typically recorded each...
... OaPDH (42) Approximately 25% of the accessible surface area ofa monomer contributes to LlPDH dimer formation Whereas LlPDH and OaPDH have a ˚ buried surface area of 5500 A2 , TbPDH has a larger ... andawater molecule The C3-OH forms hydrogen-bonding interactions with the catalytic Lys184 and two asparagines (Asn188 and Asn102) Lys184 also interacts with the carbonyl oxygen of Val129 and ... thermal parameters (B-factors) and, where appropriate, the ligand occupancies Superposition of subunit A on B and C (468 Ca atoms) in complex II and III of LlPDH gives an rmsd of ˚ 1.6 A in each case,...
... anesthesia workload and that a typical epidural takes about half the time ofa typical cesarean Accordingly, the OAAI for each hospital was calculated as ((0.75 * number of epidurals per year) + (1.5 ... (1) The ratio of the epidural and cesarean components of the OAAI (OAAI EPI and OAAI CD) was also calculated as follows: OAAICD/EPI = ( no of cesareans per yr *1.5 ) / ( no of epidurals per yr ... Obstetric anesthesia workload demand in Israel has increased due to both an increase in the requests for labor analgesia anda marked increase in the cesarean delivery rate We propose a new workload-driven...
... oviduct: a regulator of local contraction and gamete transport J Cardiovasc Pharmacol 2004, 44 Suppl 1:S248-51 111 Wijayagunawardane MP, Miyamoto A, Taquahashi Y, Acosta TJ, Nishimura M, Sato K: Angiotensin ... except for isoquinoline which had a picomolar LOAEL in the ciliary beat frequency assay Many of the compounds in Table were also screened using a chick chorioallantoic membrane (CAM) assay that measures ... femtomolar range (Table 1) In general, if a chemical were inhibitory, it acted in all three bioassays, although the potency and efficacy fora particular chemical varied among the assays Some of the...
... interest and encouragement andfor providing the antibodies against serum albumin We also thank H O Bader, S Thiele for animal care, P A eldt for advice and help, and V Ashe for typing andfor linguistic ... Materials and methods TRH-degrading Lectin Brain enzyme Serum enzyme Liver enzyme SNA (Sambucus nigra A. ) GNA (Galanthus nivalis A. ) MAA (Maackia amurensis A. ) DSA (Datura stramonium A. ) ConA (Concanavalin ... the activityof lactate dehydrogenase (d) and the activityof the TRH-DE (s) as described in Materials and methods (n ¼ 10; values are mean±SD) Influence of thioacetamide, a hepatotoxin, on the activity...
... identity Data collection and Statistical analysis Real time PCR data was assembled using the LightCycler computer application software 4.05 dedicated for the LightCycler 2.0 All data was analyzed ... was not statistically significant; P = 0.6098 Due to the nature of the measurement real time RTPCR data was log-transformed and then analyzed against existence of potential subpopulations varying ... EMP2, MAL2 and SLC 6A8 may serve as potential markers for CTC derived from breast, endometrial, cervical, and ovarian cancers [41] Also mamoglobin gene expression is a sensitive molecular marker for...
... spread and vascular invasion with distant metastases free survival (MFS) in all invasive carcinomas and the subgroup of IDC in an univariate analysis However, there was no significant association ... distant metastases There was a significant direct relationship of Cyclin E expression with distant metastases for all invasive carcinomas and the IDC group when cyclin E was stratified as negative ... prognostic value as there is a direct statistical association with the development of distant metastases in all invasive carcinomas, the subgroup of invasive ductal carcinomas and in the node negative...
... trial at the University of North Carolina Ambulatory Care Center in the General Internal Medicine practice (ACC-GIM) This is an academic practice that cares for over 5,000 adults aged 50 and older ... controlled trial performed by Zapka and colleagues that mailed a colon cancer screening educational video to 450 primary care patients before their scheduled appointment fora physical exam Their ... design, analysis of data, interpretation of data, and revision of the manuscript Furthermore, all authors have approved the manuscript in its final version Acknowledgements The authors wish to thank...
... (acidic) and 7.4 (physiological) and incubated at 37°C At specific time intervals, the drug released solution was replaced with equal amount of fresh media and the amount of DOX released was analyzed ... concentration (CMC) was calculated on the basis of absorption vs logarithmic polymer concentrations Micelles were also analyzed by 1H NMR using deuterated waterasa solvent Preparation and characterization ... breast adenocarcinoma (MCF7) and glioblastoma (U87MG) Cellular uptake of micelles was observed and compared to free DOX using confocal microscopy and FACS Furthermore, the antiproliferative activity...
... trial at the University of North Carolina Ambulatory Care Center in the General Internal Medicine practice (ACC-GIM) This is an academic practice that cares for over 5,000 adults aged 50 and older ... controlled trial performed by Zapka and colleagues that mailed a colon cancer screening educational video to 450 primary care patients before their scheduled appointment fora physical exam Their ... design, analysis of data, interpretation of data, and revision of the manuscript Furthermore, all authors have approved the manuscript in its final version Acknowledgements The authors wish to thank...
... important for standardising asthma diagnosis criteria in such a population It is also important to obtain an accurate history of steroid and other asthma treatments during follow up As intranasal ... monthly maintenance dose equivalent to at least 3.2 µg of Der and 1.6 µg of Der was reached Statistical analyses The data were analyzed with SAS-PC statistical package (SAS Institute, Cary, NC) ... management of rhinitis: complete guidelines of the Joint Task Force on Practice Parameters in Allergy, Asthma and Immunology American Academy of Allergy, Asthma, and Immunology Ann Allergy Asthma Immunol...
... triglycerides In addition, an enzymatic activityfor the following proteins was measured: alanine aminotransferase, alkaline phosphatase, aspartate aminotransferase, lactate dehydrogenase, and sorbitol ... USA) and serum was separated Clinical chemistry analysis was performed on all rats using a COBAS MIRA (Roche Diagnostics, Montclair, NJ, USA) using commercially available reagents from Equal ... The amount and quality of the cRNA was assessed using a NanoDrop ND-1000 spectrophotometer and an Agilent Bioanalyzer The cRNA was then fragmented and hybridized to the Rat Genome 230 2.0 Array...
... classed as financial contributions even though they are not within the strict meaning of the term.21 In a debate of Canada over two dispute cases, Canada – Dairy and Canada – Aircraft it was ... som ska visas här Having experience of anti-subsidy cases is a reasonable way for Vietnam to learn about them Before taking part in anti-subsidy cases as an independent plaintiff Vietnam should ... countries asa concerned party to acquire useful experience Relevant here are the cases relating to subsidy and anti-subsidy on the export of sugar cane between Australia, Brazil, and Thailand and...
... of PAC increased with increase in the amount oforganic carbon on PAC The adsorption capacity of PAC after 4th incubation was almost the same as that in the aeration tank - 254 - Journal ofWater ... biofilm on PAC also decreased the adsorption capacity of PAC in the aeration tank References APPA-AWWA -Water Pollution Control Federation, (1989) Standard Methods for the Examination ofWaterand ... obtained from a municipal wastewater treatment plant in The activated sludge was acclimated by a synthetic wastewater for more than 20 days to have stable operation of the PACT process before...
... reduce ammonia losses and plant damage (Simon, 2002) There were some data of the chemical feces and urine composition of the human and animal in Vietnam (Table 3) as well as average rate of excretion ... urine as mineral fertilizer Poster Bonn University, Germany Vietnam National program on Clean waterand Rural sanitation (2002) Objectives of national strategies on clean waterand rural sanitation ... living standards, education and health conditions, and others Asa result, the farmers are limited to receive enough clean water supply and sanitation facilities asa social beneficiary Furthermore,...