acid base chemistry and titrations help solve a mystery
Báo cáo y học: " Acid-base balance and hydration status following consumption of mineral-based alkaline bottled water" ppt
Ngày tải lên :
11/08/2014, 23:21
... alkaline minerals on acid- base balance in humans Nut J 2009 11 Welch AA, Mulligan A, Bingham SA, Khaw K: Urine pH is an indicator of dietary acid- base load, fruit and vegetables and meat intakes: ... Diet Analysis software (Axxya Systems, Stafford, TX USA) for an evaluation of average daily macronutrient and micronutrient content, as well as average daily caloric intake These data were also ... Murakami K, Sasaki S, Takahashi Y, Uenishi K: Association between dietary acid- base load and cardiometabolic risk factors in young Japanese women Br J Nut 2008, 100:642-651 Wynn E, Lanham-New SA,...
- 12
- 480
- 0
Access: Acid-Base, Fluids, and Electrolytes - part 1 pdf
Ngày tải lên :
12/08/2014, 05:21
... DIURETICS MARK A PERAZELLA 103 DISORDERS OF K+ BALANCE (HYPO- AND HYPERKALEMIA) MARK A PERAZELLA 131 METABOLIC ACIDOSIS DINKAR KAW AND JOSEPH I SHAPIRO 171 METABOLIC ALKALOSIS DINKAR KAW AND JOSEPH ... Robert Sr and Nancy, my son Rob, and my brothers Steven and Fred, whose help and support are invaluable in both my life and career Also to Marc Siegelaub and Brad Thomas, who taught me the value of ... ■ Balance between Na+ intake and Na+ excretion ■ Regulated by a complex system acting via the kidney Normally, Na+ balance is maintained without edema or BP changes across a broad range of Na+...
- 45
- 216
- 0
Access: Acid-Base, Fluids, and Electrolytes - part 3 pot
Ngày tải lên :
12/08/2014, 05:21
... disease Nausea and vomiting, and headache are adverse effects Acetazolamide (primarily proximal tubular) A CA inhibitor that alkalinizes the urine, prevents and treats altitude sickness, and ... (mean arterial pressure, peritubular capillary pressure, and renal interstitial pressure) affect handling of Na+ and water Na+ reabsorption is driven by Na+-K+ ATPase located on basolateral membrane ... disease, hypercalcemia, lithium treatment, obstruction, and hypokalemia are causes ■ Both hypokalemia and hypercalcemia are associated with a significant downregulation of aquaporin-2 ■ Drugs may...
- 50
- 182
- 0
Access: Acid-Base, Fluids, and Electrolytes - part 4 docx
Ngày tải lên :
12/08/2014, 05:21
... 6–5 Assessing Acid- Base Balance— Bicarbonate Reclamation 182 6–6 Assessing Acid- Base Balance— Distal Nephron 184 6–7 Net Acid Excretion 185 6–8 Ammoniagenesis 187 6–9 Clinical Approach to the Patient ... when an anion is metabolized to a neutral substance proton(s) are consumed and a bicarbonate generated (citrate or anionic amino acids) [HA] = Keq × [H+] [A ] After rearranging and log transformation ... nonvolatile acids and bases and the ingestion of a normal “Western diet” to maintain acid- base homeostasis the kidney must excrete this acid load The role of the kidney in acid- base homeostasis can...
- 50
- 139
- 0
Access: Acid-Base, Fluids, and Electrolytes - part 7 potx
Ngày tải lên :
12/08/2014, 05:21
... much larger than the modestly but significantly increased SAG 304 RESPIRATORY AND MIXED ACID- BASE DISTURBANCES FIGURE 8–3: Acid- Base Nomogram A second approach to the evaluation of mixed acid- base ... postmenopausal woman, a normal physical examination, and evidence of MEN Initial evaluation Careful history and physical examination Of patients with primary hyperparathyroidism about 20% have signs and ... mechanism for the majority of chronic compensation As PaCO2 decreases and arterial pH increases, renal excretion of acid and retention of bicarbonate are reduced RESPIRATORY AND MIXED ACID- BASE...
- 50
- 201
- 0
Access: Acid-Base, Fluids, and Electrolytes - part 9 potx
Ngày tải lên :
12/08/2014, 05:21
... causes are malabsorption and diarrhea; a careful history and physical examination should reveal these disorders • Hypomagnesemia from decreased oral intake alone and primary intestinal hypomagnesemia ... for the Na+-K+ ATPase and hypomagnesemia decreases pump activity; as a result, intracellular K+ decreases with hypomagnesemia and depolarizes the cardiac myocyte resting membrane potential The ... can vary from 25% to 80% • The majority of Mg2+ absorption occurs in small intestine via both a paracellular and transcellular pathway • Magnesium absorption is affected by water absorption and...
- 50
- 229
- 0
Access: Acid-Base, Fluids, and Electrolytes - part 10 ppt
Ngày tải lên :
12/08/2014, 05:21
... Presentation Advanced age, CKD, and GI disturbances that enhance Mg2+ absorption such as decreased motility, gastritis, and colitis are contributing factors • Cathartics, antacids, and Epsom salts are ... bicarbonate reclamation, 182–183 new bicarbonate production, distal nephron, 184 acid- base biology /chemistry acid- base balance assessment, 180 acid- base homeostasis, 175 buffering bicarbonate ... afferent and efferent arteriolar resistance Autoregulation and TGF interact to maintain RPF and GFR constant Abbreviations: RPF, renal plasma flow; GFR, glomerular filtration rate; TGF, tubuloglomerular...
- 49
- 186
- 0
Chemistry and interfacial mechanics of a phase change material on metal surfaces
Ngày tải lên :
03/10/2015, 20:33
... thermal resistance of a commercial thermal interface material (TIM) As the name implies, TIM is a material sandwiched between a chip and a heat spreader and/ or a heat sink Details of thermal interface ... blocks, a temperature and a pressure control system as well as a data acquisition system A schematic diagram, not drawn to scale, and an actual photograph of the setup is as shown in Figure 3. 2a and ... chip Chemistry and Interfacial Mechanics of a Phase Change Material on Metal Surfaces PCM Characterization Thermal Resistance Measurement Setup Surface Characterization Interaction of PCM on Metal...
- 100
- 327
- 0
Effect of unsaturated fatty acid esters of biodiesel fuels on combustion, performance and emission characteristics of a DI diesel engine
Ngày tải lên :
05/09/2013, 15:28
... unsaturation, maximum heat release rate and peak pressure for karanjia biodiesel Biodiesel of karanjia has a lower percentage of unsaturation and has a higher value of maximum heat release rate than those ... Entrance Examinations, Anna University, Chennai He has published more than 40 international articles, 37 international conference papers, national journal papers, and 21 national conference papers ... can take place and the initial hydrocarbons may reduce to CO, H2, and H2O As the local temperature is not enough at this stage, very little oxidation reactions take place Increase in unsaturation...
- 20
- 483
- 0
Tài liệu Báo cáo khoa học: Looking for the ancestry of the heavy-chain subunits of heteromeric amino acid transporters rBAT and 4F2hc within the GH13 a-amylase family ppt
Ngày tải lên :
18/02/2014, 13:20
... mentioning that, especially in higher animals (mammals and also in frogs and fishes), an aspartate (aspartic acid 248 in human 4F2hc; aspartic acid 380 in Fig as both the N-terminal and transmembrane segments ... Takata H, Kuriki T, Okada S, Takesada Y, Iizuka M, Minamiura N & Imanaka T (1992) Action of neopullulanase Neopullulanase catalyzes both hydrolysis and transglycosylation at a- (1 fi 4)- and a- (1 ... stimulates dibasic and neutral amino acid transport and has sequence similarity to glucosidases Proc Natl Acad Sci USA 89, 5596–5600 Chillaron J, Roca R, Valencia A, Zorzano A & Palacin M (2001)...
- 14
- 564
- 0
Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx
Ngày tải lên :
18/02/2014, 17:20
... Proc Natl Acad Sci USA 102, 4235–4239 Shikata Y, Watanabe T, Teramoto T, Inoue A, Kawakami Y, Nishizawa Y, Katayama K & Kuwada M (1995) Isolation and characterization of a peptide isomerase from ... Kumagaye KY, Nakajima K, Watanabe T, Kawai T, Kawakami Y, Niidome T, Sawada K, Nishizawa Y et al (1994) Omega-agatoxinTK containing D-serine at position 46, but not synthetic omega-[L-Ser46]agatoxin-TK, ... assigned and integrated, with concomitant cycles of structure calculations for evaluation of distance and angle constraint violations as well as assignments of additional peaks based on the preliminary...
- 12
- 616
- 0
Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx
Ngày tải lên :
19/02/2014, 06:20
... 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢ For derivitization with TMR, a Gly-Gly-Cys sequence was introduced at the ... hides a large amount of the hydrophobic surface area Surface area calculations for the pentamer give a total surface ˚ ˚ area of $ 81 000 A2 with 30% ($ 24 000 A2 ) as contact area Thus, a large amount ... 5¢-CTGCTGTCTACCTTTGGAGGTTGCTGATCCGAA TTCGAG-3¢ (forward) and 5¢-GCTCGAATTCGGATCAG CAACCTCCAAAGGTAGACAGCA-3¢ (reverse) BL21 cells were transformed with the pETM11 construct and grown until a D of 0.8...
- 10
- 647
- 0
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf
Ngày tải lên :
20/02/2014, 01:20
... Luria–Bertani broth and isopropyl thio-b-d-galactoside were purchased from USB (Cleveland, OH) Salmon testes DNA and some analytical grade chemicals such as EDTA, Tris ⁄ HCl, CaCl2, NaCl and ... wild-type and ‘not detectable’ for W14 0A and W140O) Flanagan et al [15] reported that multiple mutations can cause large changes in the average conformation of denatured proteins Here we show that a ... et al Staphylococcal nuclease refolding investigated Two point-mutated proteins, with a single base substitution of alanine for tryptophan (W14 0A) and alanine for lysine (K13 3A) , and two truncated...
- 7
- 551
- 0
Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt
Ngày tải lên :
08/03/2014, 08:20
... acid- substituted SP analogues [HGly9]SP, [b2-HAla9]SP and [b3-HAla9]SP may adopt conformations around residue that are analogous to those adopted by a- amino acids (Gly, Ala, Sar, Pro) To explain the slightly ... to solvent variation, causing an underestimation of calculated CSDs These CSDHa and CSDCa variations demonstrate the formation of more stable and abundant helical structures for [Aib9]SP than ... C-terminal heptapeptide of NKA, another peptide of the tachykinin family that binds the NK-1 and NK-2 receptors [HGly8] NKA(4–10) is as potent as NKA and [Ala8]NKA on rabbit pulmonary artery and rat...
- 11
- 860
- 0
Analysis and practical implementation of a model for combined growth and metabolite production of lactic acid bacteria
Ngày tải lên :
05/05/2014, 08:44
... undissociated lactic acid is then further related to the total amount of lactic acid LaHtot and the pH by the lactic acid chemical equilibrium As explained above, the approach of Nicolaı et al is based ... is assumed that the medium also contains a strong acid AH, allowing to manipulate the initial medium with dissociation constants KLaH and KBuH In combination with the associated charge and mass ... production rate to [LaH] and pH, the accuracy of latter input values is also of major importance Therefore, an adequate calculation method for the actual values of [LaH] and pH at each time point during...
- 12
- 625
- 0
the tao of chemistry and life a scientific journey jun 2009
Ngày tải lên :
11/06/2014, 06:32
... With offices in Argentina Austria Brazil Chile Czech Republic France Greece Guatemala Hungary Italy Japan Poland Portugal Singapore South Korea Switzerland Thailand Turkey Ukraine Vietnam Copyright ... nature is divided into three great domains The three great domains of life on Earth are the Archaea, the domain of archaeans, the Eubacteria, the domain of bacteria, and the Eukarya, the domain ... Methane is a simple but really important molecule Methane is a flammable gas, often called “marsh gas” or “natural gas.” Methane, as natural gas, is widely used as an energy source for domestic and...
- 427
- 226
- 0
Báo cáo lâm nghiệp: "development of winter hardiness of pine and spruce seedlings in a simulated acid rain experimen" potx
Ngày tải lên :
09/08/2014, 04:20
... unhardened state in March-April, when the starch grains again appeared (Fig 4) The exposure to acid rain did not were seen to accumulate in chloroplasts The develfreezing injury in the acid rain-treated ... membrane-free areas of the chloroplasts The highest incidence of these was noted in March-April, when also large, whorl-like membranous structures were seen in abundance in chloroplast stromata ... containing granular material developed in the cytoplasm Myelin-like membranous formations in the cytoplasm became abundant during the winter period (Fig 3) As of September, small, single-membrane fragments...
- 3
- 214
- 0
Báo cáo y học: " Serum levels of hyaluronic acid and chondroitin sulfate as a non-invasive method to evaluate healing after cartilage repair procedures" pptx
Ngày tải lên :
09/08/2014, 14:21
... demonstrated better visual and histological appearance than those treated with drilling Three of the five AC biopsies were near normal, and the other two showed at least 50% fill and peripheral integration ... cell-based therapy, such as ACI [5], over marrowstimulation techniques, such as SD or microfracture Second, the authors describe two potential candidate factors to follow tissue maturation and healing: ... aimed at repairing articular cartilage, assist surgeons to select the appropriate procedure for any given patient, and post-operatively, allow an individualized determination of when it is safe...
- 2
- 358
- 0
Báo cáo y học: "Type I interferon receptor controls B-cell expression of nucleic acid-sensing Toll-like receptors and autoantibody production in a murine model of lupus" doc
Ngày tải lên :
09/08/2014, 14:22
... past years, PJU has served as a consultant to Centocor, Inc (Horsham, PA, USA), Biogen Idec (Cambridge, MA, USA), Avanir Pharmaceuticals (Aliso Viejo, CA, USA), Amgen (Thousand Oaks, CA, USA), ... Institutional Animal Care and Use Committee Autoantigen microarrays Antigens were printed in ordered arrays on FAST slides (Whatman, now part of GE Healthcare, Piscataway, NJ, USA) Arrays were ... lupus autoantigen microarrays that contained more than 50 candidate SLE autoantigens A table containing raw median pixel intensity minus background values for all array antigens is provided [see Additional...
- 10
- 408
- 0
Tìm thêm:
- hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam
- xác định các mục tiêu của chương trình
- xác định các nguyên tắc biên soạn
- khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn
- khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản
- khảo sát chương trình đào tạo gắn với các giáo trình cụ thể
- xác định thời lượng học về mặt lí thuyết và thực tế
- tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam
- điều tra đối với đối tượng giảng viên và đối tượng quản lí
- điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1
- khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam
- khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu
- nội dung cụ thể cho từng kĩ năng ở từng cấp độ
- xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct
- phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ
- mở máy động cơ lồng sóc
- mở máy động cơ rôto dây quấn
- các đặc tính của động cơ điện không đồng bộ
- hệ số công suất cosp fi p2
- đặc tuyến hiệu suất h fi p2