achieving virtual presence using ultrabroadband internet in a critical clinical application initial results
Báo cáo toán học: " On transmission performance of OFDM-based schemes using MMSE-FDE in a frequencyselective fading channel" pot
... sequence is interleaved before data modulation A block interleaver used as channel interleaver in the simulation is of size 2a and 2b block interleaver, where a and b are the maximum allowable integers ... September 2001) H Gacanin, S Takaoka, F Adachi, OFDM combined with TDM using frequency-domain equalization J Commun Netw 9(1), 34–42 (2007) H Gacanin, F Adachi, PAPR advantage of amplitude clipped ... 1} One-tap MMSE-FDE [3] is applied to R(n) as s(t) Frame generation Info data JNm-point IFFT Data modulation Gacanin and Adachi EURASIP Journal on Wireless Communications and Networking 2011,...
- 10
- 482
- 0
Modelling Load Shifting Using Electric Vehicles in a Smart Grid Environment pdf
... predictable and can be estimated from traffic and road-use data Figure indicates a typical daily travelling pattern of gasoline-driven cars in Japan It shows that 50% of gasoline-fuelled cars travel ... at: shinichi.inage.wk@hitachi.com or David Elzinga at david.elzinga@iea.org International Energy Agency Shin-ichi Inage WO R K I N G PA P E R Modelling Load Shifting Using Electric Vehicles in ... than 30 km per day, and that 30% of gasoline-fuelled cars travel less than 15 km per day Figure 5: Typical daily travelling patterns of gasoline-fuelled cars in Japan Source: Sagawa and Skaguchi,...
- 76
- 184
- 0
SKKN using teaching aids in a language class
... are teaching aids ? Definition: According to Peter Wingard in Teaching English as an international Language – A Practical Guide – teaching aids are any thing from a detailed syllabus, a text ... convinient and effective use in a language class Tæ KHXH – English Group Using teaching aids in a language class – By Truong Quang Khanh Audio-visual aids: Audio visual aids are the combination ... Now say “walking“ Tæ KHXH – English Group Using teaching aids in a language class – By Truong Quang Khanh Sts: Walking, walking T: Are you walking now ? Sts: No, we aren’t We are sitting at the...
- 11
- 421
- 0
Road detection using intrinsic colors in a stereo vision system
... while some fast classification methods are used to remove vegetation in the training area 4.3.1 Training area The training area is a small area defined in the image Since road color samples will ... function A crucial parameter of this method is the angle of invariance θ Originally, this angle was obtained via a calibration procedure, involving using the calibrated camera to capture images in ... Brightness-invariant feature [20] Remarks Invariant to brightness Invariant to brightness Invariant to brightness Not invariant to intra-image changes, e.g shadows Not invariant to intra-image changes,...
- 98
- 488
- 0
Localizing Client-Side Data in a Web Forms Application
... These classes are useful in writing globalized applications Within this namespace, the CultureInfo class represents information about a specific culture and is used in culture-specific operations ... cultureNativeNameLabel.Text = CultureInfo.CurrentCulture.NativeName; } // Sample data that might come from a database // displayed according to culture set by user dateLabel.Text = DateTime.Now.ToString("D"); ... culture-specific operations Fortunately, NET provides a collection of classes which makes this relatively easy The System.Globalization namespace contains classes that specify culture-related information These...
- 4
- 367
- 0
Báo cáo " North Atlantic Treaty - a global document in a Critical Discourse Analysis " docx
... settle any international dispute in which they may be involved by peaceful means in such a manner that international peace and security and justice are not endangered, and to refrain in their international ... security of any of the Parties is threatened Article The Parties agree that an armed attack against one or more of them in Europe or North America shall be considered an attack against them all and consequently ... modal auxiliaries in the Treaty, mainly “shall” and “will” are used This is understandable because the Treaty also operates as a law Radolph Quirk and Sidney Greenbaum in A University Grammar...
- 10
- 375
- 0
using uml for modeling a distributed java application 1997
... method calls to this object in a transparent way The RMI mechanism takes care of marshaling and unmarshaling parameter objects using object serialization RMI and object serialization are tightly integrated ... 7.1 and 7.3 The third basic use case is Manage Teachers, which contains functionality for adding and removing teachers and for changing their data Manage Teachers Staff Editor Maintain ... break planner application 4.1.2 Description of Use Cases Manage Break Plans Handle break plans as a whole This includes creation and deletion, opening and closing, and printing of break plans as...
- 57
- 227
- 0
Báo cáo y học: "First somatic mutation of E2F1 in a critical DNA binding residue discovered in well- differentiated papillary mesothelioma of the peritoneum" doc
... GCAGCCACAGTGGGTATTACT 3' E2F1_R: 5' GGGGAGAAGTCACGCTATGA 3' TRAF7_F 5’ GCCTTGCTCAGTGTCTTTGA 3’ TRAF7_R 5’ CATGTTGTCCATACTCCAGACC 3’ PPFIBP2_F: 5’ CCCTCGAGCCATTTGTATTT 3’ PPFIBP2_R: 5’ CCACAGCAGAAGCTGAAAGA ... (5’-GGTTAATGGAGGTGTGTGAAGTC-3’) Cyclin E1-R (5’-CCATCTGTCACATACGCAAACT-3’) APAF1-F (5’-TGACATTTCTCACGATGCTACC-3’) APAF1-R (5’-ATTGTCATCTCCCGTTGCCA-3’) GAPDH-F (5’-GTGGACCTGACCTGCCGTCT-3’) GAPDH-R ... considered statistically significant Abbreviations ANOLEA: Atomic Non-Local Environment Assessment; ANOVA: analysis of variance; AP1: activator protein 1; APAF1: apoptotic peptidase activating factor...
- 40
- 426
- 0
Báo cáo y học: "A first city-wide early defibrillation project in a German city: 5-year results of the Bochum against sudden cardiac arrest study" potx
... recommends AED installation in places where a cardiac/circulatory arrest is to be expected within two years, whereas the AHA recommends installation in places where a cardiac/circulatory arrest is ... a descriptive report of the implementation and clinical outcomes of an early defibrillation programme in a German urban area over five years passerby, and in four cases, the AED was used by alerted ... cardiac arrest (SCA) in public places where AEDs are installed as shown in the British National Defibrillator Programme [20] In that study, hospital discharge after SCA was achieved in over one-quarter...
- 6
- 317
- 0
DETOXIFICATION OF TRICHLOROETHYLENE (TCE) USING SOLAR LIGHT/TiO2 IN A UV CONCENTRATING RADIATION SYSTEM
... TCE degradation were examined MATERIALS AND METHODS TCE (99+%) was obtained from Aldrich Chemical Co, and the TiO2 used was Degussa P-25, which was mostly anatase and had a BET surface area of 50-m2/g ... alone) Figure Schematic diagram of photocatalytic solar reactor - 39 - The dark reaction was initially carried out by injecting a sampling of TCE into the slurry of TiO2 to given a final solution of ... TiO2 dosage - 41 - These results indicate that a 0.2 wt% TiO2 loading is sufficient to harvest all the incident light, and that there is no advantage to a loading above this value Additionally,...
- 6
- 392
- 0
A New Technique Using Headspace Gas Monitoring to Determine Carbon Source Addition in a BNR Process
... profile of TAD supernatant and NaAc addition Observed CO2 evolution rates were similar in both cases, and the TAD supernatant VFA estimations are shown in Table Estimations showed a substantial overestimation, ... on the basis of tests using the same batch of sludge sample Acetate and VFAs concentrations were verified using a Hewlett-Packard® 588 0A gas chromatograph, equipped with a flame ionization detector ... sodium acetate concentrations were estimated using this linear correlation and their verification (by gas chromatograph analysis) are shown in Table The estimated error was less than %, in four...
- 6
- 405
- 0
Exergoeconomic optimization and improvement of a cogeneration system modeled in a process simulator using direct search and evolutionary methods
... the beginning of each iteration is performed The analysis provides information to hierarchically classify the components as main, secondary, and remainder, and to define main decision variables ... 1972 Holland J.H Adaptation in Natural and Artificial Systems The University of Michigan Press: Ann Arbor, 1975 Okamoto M., Nonaka T., Ochiai S., Tominaga D Nonlinear numerical optimization with ... steam and process hot water demands are also equality constraints [19] The inequality constraints are represented by the allowable ranges of variation of the decision variables, presented in Table...
- 14
- 593
- 0
Optimal placement of horizontal - and vertical - axis wind turbines in a wind farm for maximum power generation using a genetic algorithm
... a wind farm of HAWT using GA gives a uniform grid arrangement similar that obtained by Grady et al [2]; this is different than that obtained by Mosetti [1] who obtained a somewhat random arrangement ... of Engineering in department of Mechanical Engineering and Materials Science at Washington University in St Louis, MO, USA He is a Fellow of ASME, AIAA, IEEE, and SAE E-mail address: rka@wustl.edu ... University in St Louis He received B.S in Mechanical Engineering from Shanghai Jiao Tong University in China in 2008 and M.S in Mechanical Engineering from Washington University in St Louis in 2010 Xiaomin's...
- 12
- 635
- 1
Developing Writing Skills in a Foreign Language via the Internet.doc
... learners can model their own work in this area of academic writing The Internet The Internet has made many opportunities available to both learners and educators that were not feasible in the past ... simply using a familiar search engine (Google, Yahoo) and typing in the subject they wish to secure more details about As an example, once again referring back to Hong Kong’s and Toronto’s weather ... their materials to make an organized essay At this point in this task, the groups that were initially assigned to work together e-mailed their finished product to the other team Once again, after...
- 5
- 576
- 0
Using Cooperative Learning to Integrate Thinking and Information Technology in a Content.doc
... pause in computer use, students can analyze what they have learned and done, share information with others, and plan their next steps After using computers, students can again analyze and share ... teachers for information, and instead can work together to find and share knowledge All the same benefits of cooperative learning presented above in the normal classroom apply equally in information ... researched information in the development of setting, character, and plot In addition, essays are evaluated for language use, particularly for one or two grammatical items on which the teacher wanted...
- 9
- 668
- 0
A study on differences of using pasive voi in english and vietnamese = nghiên cứu về sự khác nhau trong cách dùng câu bị động của tiếng anh và tiếng việt luận văn tốt nghiệp đại học
... Vietnamese These practical applications are very helpful for language learners and such a research is the goal the author aimed at Some analysis and contrastive points between English and Vietnamese ... contrast and implications for teaching and learning languages made above, I hope that this paper can help students and teachers have better knowledge and correct translations of the passive-meaning ... hoc bac bo (co ca y kiờn cua Bụ Sc khoe c va New Zealand) Eg 2: An initial safety assessment is made by ANZFA experts, with public comment invited should be translated: Chuyờn gia ANZFA anh gia...
- 46
- 1,425
- 6
Tài liệu Using Indexers in a Windows Application doc
... class that returns a PhoneNumber and accepts a single Name parameter Implement this indexer in the same way as the first one (again note that PhoneNumber is a struct and therefore always has a ... indexers In the PhoneBook.cs source file, add a public read-only indexer that returns a Name and accepts a single PhoneNumber parameter to the PhoneBook class Leave the body of the get accessor blank ... item in the array that matches The first argument to IndexOf is the array to search through (phoneNumbers) The second argument to IndexOf is the item you are searching for IndexOf returns the integer...
- 6
- 353
- 0
Using compensation strategies in listening for 10th form students a case study at the high school for gifted students of vinh university
... Cognitive Strategies Employing actions Practicing Receiving and sending messages Analyzing and reasoning Creating structures for Centering learning Arranging and planning learning Evaluating learning ... gathering and organizing materials, arranging a study space and a schedule, monitoring mistakes, and evaluating task success, and 27 evaluating the success of any type of learning strategy) are ... Adjusting/ Approximating Speaking Speaking Speaking, Writing Speaking, Writing Speaking, Writing the message i Coining words j Using a circumlocution or Speaking, Writing Speaking, Writing synonym...
- 99
- 805
- 0
Tài liệu Using XPath to Query Data in a DataSet doc
... ConfigurationSettings.AppSettings["Sql_ConnectString"]); DataTable orderTable = new DataTable(ORDERS_TABLE); da.Fill(orderTable); ds.Tables.Add(orderTable); // Fill the OrderDetails table and add it to the DataSet da = new SqlDataAdapter("SELECT ... [Order Details]", ConfigurationSettings.AppSettings["Sql_ConnectString"]); DataTable orderDetailTable = new DataTable(ORDERDETAILS_TABLE); da.Fill(orderDetailTable); ds.Tables.Add(orderDetailTable); ... = new DataSet("Orders_OrderDetails"); SqlDataAdapter da; // Fill the Order table and add it to the DataSet da = new SqlDataAdapter("SELECT * FROM Orders", ConfigurationSettings.AppSettings["Sql_ConnectString"]);...
- 4
- 442
- 0
A study of using english songs as a type of supplementary material in teaching listening for first year non major students of english at phuong dong university
... identify and understand what others are saying This involves understanding a speaker's accent or pronunciation, his grammar and his vocabulary, and grasping his meaning Defined with those characteristics, ... years; teachers and researchers believe that motivation plays an important part in the process of acquiring an additional language because motivated students are usually those who participate actively ... students’ interest in learning English In short, speaking like Finocchiaro (1973:174) by using songs “language learning can be combined with recreation or aesthetic appreciation for a change of pace in...
- 39
- 1,125
- 3
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25