0

acetylation chromatin remodeling plays a critical role in the triggering progression of cardiac hypertrophy

Báo cáo y học:

Báo cáo y học: "Translational control plays a prominent role in the hepatocytic differentiation of HepaRG liver progenitor cells" docx

Báo cáo khoa học

... demonstrate an increased translation of these transcripts and validate the array data indicating no change or a slight decrease in LTBP1, SYNE-1 and MMP3 transcript levels in the total RNA compartment and ... and polysomal of the array data by on sucrose gradient Validation Validation of the array data by real time PCR (a) using total and polysome-bound RNA populations and (b) using individual fractions ... of the reverse transcriptase, RNA amounts were equalized by adding an appropriate amount of in vitro transcribed irrelevant RNA to each fraction, giving a final amount of μg of RNA on each sample...
  • 14
  • 384
  • 0
Báo cáo y học:

Báo cáo y học: "The membrane-spanning domain of gp41 plays a critical role in intracellular trafficking of the HIV envelope protein" pptx

Báo cáo khoa học

... CTACCAAGCC TCC, 696 +A, GGCTTGGTAGGTTTAGCTAGAATAGTTTTTGCT/AGCAAAAACTATTCTAGCTAAAC CTACCAAGCC,695+ 2A, GAGGCTTGGTAGGTGCTG CCTTAAGAATAGTTTTTGC/GCAAAAACTATTCTTAAGGCAGCACCTACCAAGCCTC,695+ 3A, GTAG GAGGCTTGGTAGGTGCGGCCGCATTAAGAATAGTTTTTGCTGTACGTACAGCAAAAACTATTCTTAATGCGGCCGCACCTACCAAGCCTCCTAC, ... GAGGCTTGGTAGGTGCGGCCGCATTAAGAATAGTTTTTGCTGTACGTACAGCAAAAACTATTCTTAATGCGGCCGCACCTACCAAGCCTCCTAC, 695+ 4A, GGAGGCTTGGTAGGTGCGGCCGCAGCCTTAAGAATAGTTT TTGCTGTAC/GTACAGCAAAAACTATTCTTAAGGCTGCGGCCGCACCTACCAAGCCT ... CC,696+ 2A, GCTTGGTAGGTTTAGCTGCCAGAATAGTTTTTGCTG/CAGCAAAAACTATTCTGGCAG CTAAACCTACCAAGC,695/696+ 2A, GAGGCTTGGTAGGTGCTGCCTTAGCTGCCAGAATAGTTTTT GCTG/CAGCAAAAACTATTCTGGCAGCTAAGGCAG CACCTACCAAGCCTC The...
  • 12
  • 337
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Plasmid-encoded NP73-102 modulates atrial natriuretic peptide receptor signaling and plays a critical role in inducing tolerogenic dendritic cells" pdf

Báo cáo khoa học

... (Figure 5A) The IP data suggest that the immunoregulation of NPRA signaling in hmDCs may involve a specific interaction among these four proteins Zhang et al Genetic Vaccines and Therapy 2011, ... from NPRA-/- mice had little lung inflammation, suggesting that NPRA signaling in DCs plays a critical role in allergic Zhang et al Genetic Vaccines and Therapy 2011, 9:3 http://www.gvt-journal.com/content/9/1/3 ... 1: Additional file This supplementary material contains additional information about the viability assay, the T cell suppression assay, the luciferase assay, and the experiments in mice 10 11 Acknowledgements...
  • 12
  • 268
  • 0
Báo cáo khoa học: A novel gene, fad49, plays a crucial role in the immediate early stage of adipocyte differentiation via involvement in mitotic clonal expansion docx

Báo cáo khoa học: A novel gene, fad49, plays a crucial role in the immediate early stage of adipocyte differentiation via involvement in mitotic clonal expansion docx

Báo cáo khoa học

... that the PX domain of p47phox binds intramolecularly to the SH3 domain in the same protein, and that this intramolecular interaction suppresses the lipid-binding activity of the PX domain in the ... 5579 fad49 plays a crucial role in adipogenesis T Hishida et al Fig Characterization of the PX domain of FAD49 (A) Phosphoinositide binding specificity of the PX domain of FAD49 Bacterially expressed ... domains, suggesting that the PX domain could bind to an SH3 domain of FAD49 To test whether the PX domain could interact with an SH3 domain in FAD49, we performed in vitro binding assays using...
  • 13
  • 385
  • 0
Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt

Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt

Báo cáo khoa học

... (Kirkegaard and Perry, Gaithersburgh, MD, USA) per well The plate was incubated in the dark for 20 and the reaction stopped by the addition of 50 lL of 0.5 M sulfuric acid The plate was read on a Labsystems ... confirms that IFN-c can increase the activity of an enzyme, LPCAT, that participates in the rapid turnover of PtdCho Lysophospholipid acyltransferases maintain membrane lipid composition and the asymmetrical ... LPCAT activity significantly inhibits LPS-induced TNF -a and IL-6 production, strongly suggesting that LPCAT plays an important role in mediating the signaling pathways for LPS-activation of these...
  • 7
  • 322
  • 0
báo cáo khoa học:

báo cáo khoa học: " The transcription factor PHR1 plays a key role in the regulation of sulfate shoot-to-root flux upon phosphate starvation in Arabidopsis" potx

Báo cáo khoa học

... 10:78 Tomatsu H, Takano J, Takahashi H, Watanabe-Takahashi A, Shibagaki N, Fujiwara T: An Arabidopsis thaliana high-affinity molybdate transporter required for efficient uptake of molybdate from ... M, Hawkesford MJ, Saito K: The roles of three functional sulphate transporters involved in uptake and translocation of sulphate in Arabidopsis thaliana Plant J 2000, 23:171-182 Kataoka T, Hayashi ... role in sulfate translocation within developing seeds Plant Physiol 2010, 154:913-926 Kataoka T, Watanabe-Takahashi A, Hayashi N, Ohnishi M, Mimura T, Buchner P, Hawkesford MJ, Yamaya T, Takahashi...
  • 10
  • 427
  • 0
Tài liệu Báo cáo khoa học: The most C-terminal tri-glycine segment within the polyglycine stretch of the pea Toc75 transit peptide plays a critical role for targeting the protein to the chloroplast outer envelope membrane ppt

Tài liệu Báo cáo khoa học: The most C-terminal tri-glycine segment within the polyglycine stretch of the pea Toc75 transit peptide plays a critical role for targeting the protein to the chloroplast outer envelope membrane ppt

Báo cáo khoa học

... Sequence (residues 91–100) WT polyAla AGG GAG GGA GAA AGA AAG GGD GGE GGL GGN GGS GGP GGGAGGGGGG *SA*AAAAA* AAA******* ****AAA*** *******AAA ****AAAAAA AAA****AAA AAA*AAA*** *******DDD *******EEE *******LLL ... multiple pathways in a way distinct from that of AGA precursor, or (c) the effect of AAG mutation on correct targeting was significantly less than that of AGA mutation Taken together with the previous ... (Fig 4A, lanes 15–18; Fig 4B,C), indicating its localization to the stroma, and thylakoid or inner membranes These data indicate that a repeat of glutamic acid cannot replace the tri-glycine segment...
  • 9
  • 496
  • 0
Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

Báo cáo khoa học

... D-galactose and 0.3% L-arabinose and is predominantly linear Potato arabinogalactan consists of 86% D-galactose and 6.6% L-arabinose, while soy arabinogalactan consists of 57% D-galactose and ... 4.5 No activity of GALA could be detected against any of the transgalactooligosaccharides listed in Materials and methods Purification and characterization of GALA Hydrolysis of arabinogalactans ... disappear in time, suggesting the presence of an arabinose-releasing activity in the GALA preparation However, no a- 1-,3-L-arabinofuranosidase activity could be detected using PNP -a- L-arabinofuranoside...
  • 9
  • 669
  • 0
Báo cáo khoa học: Transmembrane helix 12 plays a pivotal role in coupling energy provision and drug binding in ABCB1 pot

Báo cáo khoa học: Transmembrane helix 12 plays a pivotal role in coupling energy provision and drug binding in ABCB1 pot

Báo cáo khoa học

... was determined as a percentage of G324C labelling, as outlined in Experimental procedures Additionally, labelling of the cysteine-less ABCB1 isoform was also examined as a negative control Any ... Catalytic intermediate CM BM FM Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP ... labelling of mutant TM12 isoforms of ABCB1 For each of the mutant isoforms, densitometric analysis was used to quantify the UV images and values of labelling at each time point These were then...
  • 12
  • 380
  • 0
Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx

Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx

Báo cáo khoa học

... pC4Meth-100TorA/P2 was constructed by PCR, using pTorA/P2 [17] as a template and the primers RRTorA-SacI-fw (5¢-GCGCGGAGCTCAAGAAGGA AGAAAAATAATGAAC-3¢, SacI site underlined) and TorA/Lep2-BamHI-rv (5¢-GCATGGATCCCGCGCGC ... SufIHAXbaI+ClaI-rv (5¢-ACTGATCGATCTAGATTACGCAT AGTCAGGAACATCGTATGGGTAGCCGCCTGGCG GTACCGGATTGACCAAC-3¢, ClaI site underlined, XbaI site in italics, HA-epitope sequence in boldface) The resulting fragments ... using an in vitro translation and crosslinking approach Nascent chains of TorA/P2, a strictly Tatdependent chimera comprising the signal peptide of TorA fused to the periplasmic P2 domain of...
  • 9
  • 393
  • 0
Báo cáo khoa học: Peroxisome proliferator-activated receptor a plays a vital role in inducing a detoxification system against plant compounds with crosstalk with other xenobiotic nuclear receptors docx

Báo cáo khoa học: Peroxisome proliferator-activated receptor a plays a vital role in inducing a detoxification system against plant compounds with crosstalk with other xenobiotic nuclear receptors docx

Báo cáo khoa học

... Cyp 2a5 ; 5¢-TTGTTCTAAAAGTTGTGCCACGG GATG-3¢ and 5¢-AGAGATGATCCCATGAGAAACGG TGAA-3¢ for Cyp 3a4 4; 5¢-AGATCATCATTCCTTGGCA CTGG-3¢ and 5¢- ATTGCAGAAAGGAGGGAAGATGG -3¢ for Cyp 4a1 0; 5¢-CCAGTTGAGTGACGAGGAG ... 5¢-CGCAGGAATGGATAAACATA AGCA-3¢ for Cyp2c38; 5¢-ACTTCTCTGTGGCAAGCCC TGTTG-3¢ and 5¢-TCCACTAGCACAGATCACAGATC ATGG-3¢ for Cyp2b9; 5¢-TGCAGAACTTCCACTTCAA ATCCA-3¢ and 5¢-AATTTCCCCCTTCTCTGGCTACC-3¢ ... 5¢-CCAGTTGAGTGACGAGGAG ATGG-3¢ and 5¢-TCTGCATGCCCTCAAATGTTACC-3¢ for Akr1b8; 5¢-ACCACTCTCTGGATGTGATTGGA-3¢ and 5¢- TCAAGAACATTTTATTTCCCACATTTT-3¢ for Ugt2b5; 5¢-ATTGCCCATATGGTGGCCAAAGGAG-3¢ and 5¢- GGCTGCCACACAAGCGAGTAGGAAT-3¢...
  • 9
  • 280
  • 0
Báo cáo Y học: The a1b1 contact of human hemoglobin plays a key role in stabilizing the bound dioxygen Further evidence from the iron valency hybrids potx

Báo cáo Y học: The a1b1 contact of human hemoglobin plays a key role in stabilizing the bound dioxygen Further evidence from the iron valency hybrids potx

Báo cáo khoa học

... this time the valency hybrid tetramers As a result, the b chain was found to acquire a noticeable resistance against the acidic autoxidation in a manner of contacting with the a chain, no matter ... state the partner a chains may take, the oxy-form or the ferric met-form Unlike separated b chains, the spontaneous formation of hemichrome was at variance with separated a chains in the pH range ... isolated a chain In contrast to this, the heme pocket of the b chain still obstructs easy access of a water molecule as well as a proton, so that the b chains can keep a constant resistance against...
  • 10
  • 648
  • 0
Báo cáo hóa học:

Báo cáo hóa học: "Rac1-mediated signaling plays a central role in secretion-dependent platelet aggregation in human blood stimulated by atherosclerotic plaque" ppt

Hóa học - Dầu khí

... acetylsalicylic acid (ASA) was added to the anticoagulant [17] The final concentration of ASA in the blood was mM Platelet aggregation and ATP-secretion in blood Whole blood platelet aggregation was ... Such a broad inhibitory profile of a Rac1 inhibitor suggests that pharmacological targeting of Rac1 is an interesting approach for developing future antiplatelet drugs Methods Materials Acetylsalicylic ... (containing 0.3% albumin) for 10 at a wall shear rate of 500s-1 Then hirudin-anticoagulated blood containing mepacrine (10 μM) in order to visualize platelets was added to the inlet well, and chambers...
  • 10
  • 441
  • 0
báo cáo hóa học:

báo cáo hóa học: " LPS preconditioning redirects TLR signaling following stroke: TRIF-IRF3 plays a seminal role in mediating tolerance to ischemic injury" doc

Toán học

... effect of TLR signaling is associated with the pathways that lead to NFB activation and pro-inflammatory responses In contrast, TLR signaling pathways that activate IRFs can induce antiinflammatory ... preconditioning changes the balance of proand anti-inflammatory cytokines and chemokines in the plasma we examined the levels of seven molecules using ELISAs The results indicate that the level of pro-inflammatory ... Figure Microarray analysis of anti-inflammatory/type I IFN and pro-inflammatory gene expression Microarray analysis revealed enhanced anti-inflammatory/type I IFN and comparable pro-inflammatory gene...
  • 12
  • 215
  • 0
Tài liệu University Oars Being a Critical Enquiry Into the After Health of the Men Who Rowed in the Oxford and Cambridge Boat-Race, from the Year 1829 to 1869, Based on the Personal Experience of the Rowers Themselves pdf

Tài liệu University Oars Being a Critical Enquiry Into the After Health of the Men Who Rowed in the Oxford and Cambridge Boat-Race, from the Year 1829 to 1869, Based on the Personal Experience of the Rowers Themselves pdf

Sức khỏe giới tính

... maintaining the theory of rowing being injurious to the health At the same time I have never doubted that his early death, at the age of twenty-nine, was due to boatracing No other member of his ... life of 389 instead of 320 years, and to each man 48*6 instead of 40 years The Table regarding these two first crews of the year 1829 m a y be calculated up to a still later date, and so may deal ... duration of life of the 1829 crews, because that race was rowed so many years ago that in discussing it we are treating rather of obtained results than of estimated probabilities; we are in fact...
  • 419
  • 541
  • 0
Báo cáo khoa học: Kinetic studies and molecular modelling attribute a crucial role in the specificity and stereoselectivity of penicillin acylase to the pair ArgA145-ArgB263 pdf

Báo cáo khoa học: Kinetic studies and molecular modelling attribute a crucial role in the specificity and stereoselectivity of penicillin acylase to the pair ArgA145-ArgB263 pdf

Báo cáo khoa học

... substrates The data for the PA catalysed hydrolysis of PhAc-Asp and PhAc-Glu [13] and our data for PhAc-pAB, PhAc-mAB and PhAcoAB (Table 2) imply that the COOH group has to be positioned as in NIPAB ... protein chain, acting as a flap, first opening and then closing the groove [45] The catalytic reaction presumably occurs when the ionized carboxyl group of PG approaches the guanidine side chain of ... several polar amino acid residues This part of the enzyme can be considered as its S1¢ binding subsite Substrate binding induces conformational changes involving the ArgA145PheA146 fragment of the...
  • 8
  • 438
  • 0
Báo cáo khoa học: Molecular dissection of the biosynthetic relationship between phthiocerol and phthiodiolone dimycocerosates and their critical role in the virulence and permeability of Mycobacterium tuberculosis doc

Báo cáo khoa học: Molecular dissection of the biosynthetic relationship between phthiocerol and phthiodiolone dimycocerosates and their critical role in the virulence and permeability of Mycobacterium tuberculosis doc

Báo cáo khoa học

... GCTCTAGAGTTTAAACATAGTCAATGAACTTGTACGC AGGAAGGCCGGCAAATGGC TTCACGTGAGATAAGCTCCC ACGGTTTCGGTGAAGCCAG ACAATTAATTAACAGTATGTACGAGCGATGCG ACAAAAGCTTGGCGCAAATCATAGCTTCTTG GACTAGTTTAAACGGATCGACGAGTTCGACGC GACTAGTTTAAACGAGGCACTGTGACCAGATGC ... GACTAGTTTAAACGGATCGACGAGTTCGACGC GACTAGTTTAAACGAGGCACTGTGACCAGATGC CGTTCTGGAGCAACCTTCG GGTCGAGGAAGTACGTGAC GCTCTAGAGCAACCGTCCGAAATATTATAAA GCTCTAGATCTCATAAAAATGTATCCTAAATCAAATATC ppsE res 1966 FEBS Journal 274 (2007) 1957–1969 ... determined by calculating the ratio of mutant to wild-type bacteria after correcting for the ratio of these strains in the inoculum It appeared that, 21 days after infection, the ratio of PMM56...
  • 13
  • 536
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "SemiPro-inflammatory cytokines play a key role in the development of radiotherapy-induced gastrointestinal mucositis" pptx

Báo cáo khoa học

... 5’-GTGCATCATCGCTGTTCATACA TNF Forward: 5’-GTGATCGGTCCCAACAAG-3’ Results 71 X66539 Reverse: 5’-AGGGTCTGGGCCATGGAA-3’ b actin Forward: 5’-AGGCCAACCGTGAAAAGATG-3’ 101 NM_031144 Reverse: 5’-ACCAGAGGCATACAGGGACAA-3’ ... weeks of radiotherapy Staining was variable between the basal and apical regions of the crypts and did not significantly change of the course of radiotherapy (Data not shown) IL-6 IL-6 staining was ... that had received no radiotherapy There was an increase in protein expression of TNF after radiotherapy, particularly after 22.5 Gy and 30 Gy as indicated by the arrow, although the staining was...
  • 8
  • 335
  • 0
Báo cáo y học:

Báo cáo y học: "Accelerated cellular senescence in degenerate intervertebral discs: a possible role in the pathogenesis of intervertebral disc degeneration" ppt

Báo cáo khoa học

... FAM – AGG GGT CCT GGC TGC CTT CCT CTT C – TAMRA 3' 5' GAC AAA TCA TCT TCA TCA CCA CCA C 3' 99.77% ADAMTS 5' GGA CCT ACC ACG AAA GCA GAT C 3' 5' FAM – CCC AGG ACA GAC CTA CGA TGC CAC C – TAMRA ... for each passage, and cumulative population doublings were calculated At each passage, an aliquot of approximately × 106 cells was taken for analysis of MTL, and regression analysis and Spearman ... PDAR PDAR PDAR 99.65% P16INK 4a 5' GGC TCT ACA CAA GCT TCC TTT CC 3' 5' FAM – CCC CCA CCC TGG CTC TGA CCA – TAMRA 5' TCA TGA CCT GCC AGA GAG AAC A 3' 99.22% MMP-13 5' CCC CAG GCA TCA CCA TTC AAG...
  • 12
  • 617
  • 0
Environmental performance and sustainable architecture  a critical review in the context of singapore public housing  2

Environmental performance and sustainable architecture a critical review in the context of singapore public housing 2

Thạc sĩ - Cao học

... matrix of pair-wise comparisons A = (aij) can be established as follows: A1 A2 An A1 a1 /a1 a1 /a2 a1 /an A2 a2 /a1 a2 /a2 a2 /an An an /a1 an /a2 an/an 149 where ai/aj = aj/ai for all ... block The calculation is based on estimates of average annual local rainfall, absorption capacity of site through permeable paving and landscaping (See 6.3.3.) All waste water in the housing block ... weights of a set of criteria (w1, w2, , wn) from that matrix The following is a brief summary of the mathematical theory of the AHP, as reference to Saaty and Vargas (1991) and Harker (1989) The matrix...
  • 75
  • 365
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25