acceleration of a free falling object with air resistance
An experimental investigation of performance and exhaust emission of a diesel engine fuelled with Jatropha biodiesel and its blends
... states of India have reserve a total of 1.72 million hectares of land for Jatropha cultivation and small quantities of Jatropha biodiesel are already being sold to the public sector oil companies ... supplement in animal feed, if the toxins are removed [23] Since India has a large waste land area suitable for Jatropha cultivation, it can supply large volume of biodiesel, in fact, nearly half a dozen ... Gravalos I., Gialamas T., Koutsofitis Z., Kateris D., Xyradakis P., Tsiropoulos Z., Lianos G Comparison of performance characteristics of agricultural tractor diesel engine operating on home and...
- 12
- 568
- 0
Tài liệu Speaking of a Free Press docx
... Speaking of a Free Press 200 Years of Notable Quotations About Press Freedoms Published by American Newspaper Association Foundation (Now The Newspaper Association of America Foundation) ... current name: The Newspaper Association of America Foundation The Newspaper Association of America Foundation was established to advance informed and intelligent media use by all citizens, especially ... ‘freedom of speech,’ ‘freedom of press’ and free assembly’ are just rhetorical myths I believe rather that they are among the most valuable realities that men have gained, and that if they are...
- 27
- 391
- 0
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc
... GATGCCTTCCAATGAATTAC GAACCAATGAAATAAGGGCG GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG GCATCAGAAAGCATAGGC TGGGAATACGATAGAGTAG GTTTAAACGAGCTCGAATTC Gene ... CCGTCGACCAAGCTTATGTTTCCTTATTTTTACAGACG CCCCCGGGGCCACTTTCTGGTG GTACAAGCTTGTAAATTTTCGATGG CATAGAATTCTTGGTAATC AAAGTCGACATGTTGTCACGTAGACAG CAAGCAGGTGAATTAGGC GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATC GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATG ... GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATG CAGGCAAGTCTGTTTATTG CTTGGATGAGCTTTCCAC CGTATAAATTACAATACCG GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTG GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTG GTATGCGATGTGGAATTTG GATGCCTTCCAATGAATTAC...
- 16
- 646
- 0
Tài liệu Báo cáo Y học: Analyses of the CYP11B gene family in the guinea pig suggest the existence of a primordial CYP11B gene with aldosterone synthase activity docx
... pool Using a combination of a primer complementary to the adapter (adapter primer: 5¢-CCATCCTAATACGACTCACTA TAGGGC-3¢) and a gene-specific sense primer (5¢-GCCG CTCGAGTTTGAGTTAGCCAGAAACTCC-3¢, ... of the order rodentia using the same data as Graur In contrast, the distance matrix algorithms again placed the guinea pig together with artiodactyls and primates, thus supporting paraphyly albeit ... bp and an ORF of 1503 bp coding for a putative mitochondrial preprotein of 501 amino acids with a calculated molecular weight of 57.7 kDa (Fig 2) After Leu24 a cleavage site for the matrix-associated...
- 9
- 671
- 0
Đề tài " On the Julia set of a typical quadratic polynomial with a Siegel disk " ppt
... π/3 with S1 at Lemma 4.10 There exist the following asymptotically universal bounds: n area(P0 An+2 ) n area(P0 n area(Pqn+1 An+2 ) n area(Pqn+1 area(Qn An+2 ) area(Qn An+2 ) An+2 ) An+2 ) n n area(P0 ... rational maps with Siegel disks; see for example [P2] and [Mc2] for the case of quadratic polynomials, and [Z1] and [YZ] for variants in the case of cubic polynomials and quadratic rational maps ... boundary of a drop U of minimal generation It then follows the boundary of U along a nontrivial arc I Finally, it returns along the boundaries of another chain of descendants of U until it reaches a...
- 53
- 383
- 0
MUTUAL BANKING: SHOWING THE RADICAL DEFICIENCY OF THE PRESENT CIRCULATING MEDIUM, AND THE ADVANTAGES OF A FREE CURRENCY docx
... serve as a standard of value: but the bill of a Mutual Bank, having a legal value only, and not an actual one, cannot serve as a standard of value, but is referred, on the contrary, to silver and ... reason that they have been adopted by the various nations as standards of value When Adam Smith and Malthus8 say that labor is a measure of value, they speak, not of the labor which an article ... measure of value is another; and the standard of value still another 'The dollar is the measure of value Silver and gold at a certain degree of fineness, are the standard of value The bill of a...
- 46
- 327
- 0
Optimal Design of a Hybrid Electric Car with Solar Cells pptx
... solar panels It exhibit a payback of 3.13 years The addition of and m2 of solar panels (cases 2-3) increases solar fraction up to 30% but also payback to 8.7 years, since the greater daily saving ... reliability of panels in case of lateral impacts) APV ,V ,MAX = (2l + w )(h − 0.9 ) − 0.1 w l FIG - SIMPLIFIED SCHEME OF SOLAR CAR (LATERAL AND REAR VIEW) The maximum panel area can be estimated as function ... components are shown The default values of the missing variables are reported in Nomenclature, while only their variations are indicated in the tables Although an exhaustive analysis of this large amount...
- 12
- 600
- 0
báo cáo hóa học:" Establishment of an animal model of a pasteurized bone graft, with a preliminary analysis of muscle coverage or FGF-2 administration to the graft" potx
... size of the bone formation was also quantitatively measured in the lateral view using Alpha Ease FC software (Alpha Innotech, San Leandro, CA, USA) The area was calculated in relation with that ... results was made and agreed upon by AS, TY and NT Tartrate-resistant acid phosphatase (TRAP) staining After radiographical examination, the femurs with the graft were decalcified with EDTA (ethylenediaminetetraacetic ... (ethylenediaminetetraacetic acid), and cut sagittally, then stained with hematoxylin and eosin and tartrate-resistant acid phosphatase (TRAP) staining in order to demonstrate the osteoclasts Deparaffinized...
- 10
- 478
- 0
báo cáo hóa học:" Functional bracing for delayed union of a femur fracture associated with Paget''''s disease of the bone in an Asian patient: a case report" pot
... as: Takigami et al., Functional bracing for delayed union of a femur fracture associated with Paget's disease of the bone in an Asian patient: a case report Journal of Orthopaedic Surgery and ... and treatment J Oral Pathol Med 1994, 23:12-16 Hashimoto J, Ohno I, Nakatsuka K, Yoshimura N, Takata S, Zamma M, Yabe H, Abe S, Terada M, Yoh K, et al.: Prevalence and clinical features of Paget's ... disease in Australia, New Zealand, North America and most European countries, but it has a low incidence in Scandinavia, and is extremely rare in the Japanese population, with a prevalence of...
- 4
- 402
- 0
Báo cáo hóa học: " Research Article On Stability of a Functional Equation Connected with the Reynolds Opera" docx
... Isac, and Th M Rassias, Stability of Functional Equations in Several Variables, vol 34 of Progress in Nonlinear Differential Equations and Their Applications, Birkh¨ user Boston, a Boston, Mass, ... Journal of Inequalities and Applications Banach algebra Ꮽ They have shown that if a mapping f : X → Ꮽ satisfies f (x ◦ y) − f (x) f (y) ≤ (3) with some > 0, then there exist a commutative C ∗ -algebra ... Boston, Mass, USA, 1998 [2] J Acz´ l and J Dhombres, Functional Equations in Several Variables, vol 31 of Encyclopedia of e Mathematics and Its Applications, Cambridge University Press, Cambridge,...
- 3
- 216
- 0
Báo cáo hóa học: "OSCILLATION OF A LOGISTIC DIFFERENCE EQUATION WITH SEVERAL DELAYS" ppt
... Israel E-mail address: brznsky@cs.bgu.ac.il E Braverman: Department of Mathematics and Statistics, University of Calgary, 2500 University Drive N.W., Calgary, Alberta T2N 1N4, Canada E-mail address: ... theory with applications in nonlinear analysis., Journal of Computational and Applied Mathematics 113 (2000), no 1-2, 255–265 , Oscillation properties of a logistic equation with several delays, ... illustrates this fact Acknowledgments L Berezansky was partially supported by Israeli Ministry of Absorption E Braverman was partially supported by the NSERC Research Grant and the AIF Research Grant...
- 12
- 291
- 0
Báo cáo khoa học: "pH-dependent modulation of intracellular free magnesium ions with ion- selective electrodes in papillary muscle of guinea pig" ppt
... stluseR tnacifingis deredisnoc saw 50.0 naht ssel eulav p A AVONA yaw-eno ,ecnairav fo sesylana serusaem detaeper dna tset-t s’tnedutS a gnisu dezylana saw atad ehT DS ± naem a sa detneserp era stluser ... ,0002 atcA mihC nilC stcepsa lacitylana dna lacinilc ,lacigoloisyhp no etadpu nA muisengaM A matsneweL ,AJ ajawahK ,H nenappraK ,E alaavreM ,EN siraS 82 382-172 ,51 ,2002 slatemoiB sllec citoyrakue ... ,AL rettalB 411-701 ,23 ,9991 locamrahP neG setycoym ralucirtnev gip aeniug dna elcsum yrallipap tar no muisengam fo stceffe cimhtyhrraitnA S ikasamaY ,T otamaY ,Y awakustaT ,M enimoA 703-992...
- 6
- 236
- 0
Báo cáo khoa học: "Case of a sigmoid colon cancer with metachronous metastases to the mesorectum and the abdominal wall" pdf
... counted, free of metastatic adenocarcinoma The patient had an uneventful recovery On rectum examination one year later a palpable extramucosal mass was noticed at the anterior rectum wall An abdominal ... survival and it seems to increase as the primary tumor stage advance In this case, a sigmoid adenocarcinoma is infiltrating 2/3 of muscularis propria with four lymph nodes harvested free of metastatic ... Sigurdson ER, Hanlon AL, Mayer RJ, Macdonald JS, Catalano PJ, Haller DG: Colon cancer survival is associated with increasing number of lunph nodes analyzed: a secondary survey of intergroup trial INT-0089...
- 4
- 463
- 0
Báo cáo khoa hoc:" Construction and characterization of a bovine BAC library with four genome-equivalent coverage" pptx
... 2.2 BAC vector preparation pBeloBAC11 was kindly provided by H Shizuya, Department of Biology, California Institute of Technology (Pasadena, Calif.) Preparation of pBeloBAC11 was carried out as ... Schibler L., Vaiman D., Oustry A. , Guinec N., Dangy-Caye A. L., Billault A. , Cribiu E.P., Construction and extensive characterization of a goat bacterial articial chromosome library with threefold ... DNA inserts with an acceptable genomic delity in a bacterial articial chromosome (BAC) library to obtain complete coverage of the genome In addition to increased clone delity and a low level of...
- 6
- 271
- 0
báo cáo khoa học: "Successful treatment of a T4 lung tumor with vertebral body invasion using fiducial markers in the thoracic spine for image-guided radiation therapy: A case report" pps
... Shirato H, Harada T, Harabayashi T, Hida K, Endo H, Kitamura K, Onimaru R, Yamazaki K, Kurauchi N, Shimizu T, Shinohara N, Matsushita M, DosakaAkita H, Miyasaka K: Feasibility of insertion/implantation ... fiducial marker placement fused to form an integrated target volume A margin of expansion of mm was used to create a clinical target volume (CTV) An additional expansion of mm was used to create a ... Fiducial markers carry several practical advantages The markers can be clearly visualized on MV imaging (Figure 9) Some centers that may not have newer modalities such as KV imaging or CBCT available...
- 5
- 279
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008